After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human CDCP1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CDCP1cDNA Clone Product Information
cDNA Size:1032
cDNA Description:ORF Clone of Homo sapiens CUB domain containing protein 1 DNA.
Gene Synonym:CD318, TRASK, SIMA135, CDCP1p
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

CDCP1 contains three extracellular CUB domains. It is a putative stem cell marker that is highly expressed in some human cancer cells and in both, typical and atypical (cancerous) colons. It interacts with CDH2/N-cadherin, CDH3/P-cadherin, SDC1/syndecan-1, SDC4/syndecan-4 and the serine protease ST14/MT-SP1. It also interacts with SRC and PRKCG/protein kinase C gamma. CDCP1 is taken as a key regulator of EGF/EGFR-induced cell migration. It has been shown that signaling via EGF/EGFR induces migration of ovarian cancer Caov3 and OVCA420 cells with concomitant up-regulation of CDCP1 mRNA and protein. Consistent with a role in cell migration CDCP1 relocates from cell-cell junctions to punctate structures on filopodia after activation of EGFR. It may be involved in cell adhesion and cell matrix association. It also may play a role in the regulation of anchorage versus migration or proliferation versus differentiation via its phosphorylation. It has been taken as a novel marker for leukemia diagnosis and for immature hematopoietic stem cell subsets.

  • Conze T, et al.. (2003) CDCP1 is a novel marker for hematopoietic stem cells. Ann N Y Acad Sci. 996 (1): 222-6.
  • Hooper JD, et al. (2003) Subtractive immunization using highly metastatic human tumor cells identifies SIMA135/CDCP1, a 135 kDa cell surface phosphorylated glycoprotein antigen. Oncogene. 22(12): 1783-94.
  • Scherl-Mostageer M, et al. (2001) Identification of a novel gene, CDCP1, overexpressed in human colorectal cancer. Oncogene. 20(32):4402-8.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items