Quick Order

Text Size:AAA

Human PPIL2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PPIL2cDNA Clone Product Information
cDNA Size:1584
cDNA Description:ORF Clone of Homo sapiens peptidylprolyl isomerase (cyclophilin)-like 2 DNA.
Gene Synonym:CYC4, CYP60, Cyp-60, FLJ39930, MGC33174, MGC787, hCyP-60, PPIL2
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

PPIL2, is an enzyme which belongs to the cyclophilin family. The cyclophilins are peptidylprolyl isomerases and are highly conserved ubiquitous. They play an important role in protein folding, immunosuppression by cyclosporin A, and infection of HIV-1 virions. PPIL2 interacts with the proteinase inhibitor eglin c and is localized in the nucleus. It contains 1 PPIL2 cyclophilin-type domain and 1 U-box domain. PPIL2 accelerate the folding of proteins. It catalyzes the cis-trans isomerization of proline imidic peptide bonds in oligopeptides.

  • Grouse LH. et al., 2003, Proc Natl Acad Sci. 99 (26): 16899-903.
  • Lennon G. et al., 1997, Genome Res. 6 (9): 791-806.
  • Payan DG. et al., 1996, Biochem J. 314 (1): 313-9.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items