Quick Order

Mouse Bruton Tyrosine Kinase / BTK Kinase Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
BTKcDNA Clone Product Information
cDNA Size:1980
cDNA Description:ORF Clone of Mus musculus Bruton agammaglobulinemia tyrosine kinase DNA.
Gene Synonym:xid, AI528679, Btk
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-Myc Vector Information
Vector Name pCMV3-N-Myc
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-Myc Physical Map

Schematic of pCMV3-N-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Mouse Bruton Tyrosine Kinase / BTK Kinase Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged on other vectors
Mouse Bruton Tyrosine Kinase / BTK Kinase Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedMG50607-ACG$345
Mouse Bruton Tyrosine Kinase / BTK Kinase Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagMG50607-ACR$345
Mouse Bruton Tyrosine Kinase / BTK Kinase Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedMG50607-ANG$345
Mouse Bruton Tyrosine Kinase / BTK Kinase Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagMG50607-ANR$345
Mouse Bruton Tyrosine Kinase / BTK Kinase Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedMG50607-CF$315
Mouse Bruton Tyrosine Kinase / BTK Kinase Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedMG50607-CH$315
Mouse Bruton Tyrosine Kinase / BTK Kinase Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedMG50607-CM$315
Mouse Bruton Tyrosine Kinase / BTK Kinase Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedMG50607-CY$315
Mouse Bruton Tyrosine Kinase / BTK Kinase Gene cDNA Clone (full-length ORF Clone)MG50607-M$195
Mouse Bruton Tyrosine Kinase / BTK Kinase Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedMG50607-NF$315
Mouse Bruton Tyrosine Kinase / BTK Kinase Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedMG50607-NH$315
Mouse Bruton Tyrosine Kinase / BTK Kinase Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedMG50607-NM$315
Mouse Bruton Tyrosine Kinase / BTK Kinase Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedMG50607-NY$315
Mouse Bruton Tyrosine Kinase / BTK Kinase Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedMG50607-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name

Bruton's tyrosine kinase (or BTK) is a type of kinase protein expressed in B lymphocytes and T cells. BTK contains a PH domain which binds phosphatidylinositol(3,4,5)-trisphosphate (PIP3). After binding to PIP3, BTK is induced to phosphorylate phospholipase C, which in turn hydrolyzes PIP2 into two second messagers, IP3 and DAG, which then modulate the activity of downstream proteins during B-cell signaling. Btk is also found implicated in the primary immunodeficiency disease X-linked agammaglobulinemia(Bruton's agammaglobulinemia). BTK played a key role in B-cell maturation as well as mast cell activation through the high-affinity IgE receptor. Patients with X-linked agammaglobulinemia have normal pre-B cell populations in their bone marrow but these B-cells can not mature and enter the circulation.

  • Hashimoto S, et al. (1996) Identification of Bruton's tyrosine kinase (Btk) gene mutations and characterization of the derived proteins in 35 X-linked agammaglobulinemia families: a nationwide study of Btk deficiency in Japan. Blood. 88(2): 561-73.
  • Ohta Y, et al. (1994) Genomic organization and structure of Bruton agammaglobulinemia tyrosine kinase: localization of mutations associated with varied clinical presentations and course in X chromosome-linked agammaglobulinemia. PNAS. 91(19): 9062-6.
  • Smith C, et al. (1994) Expression of Bruton's agammaglobulinemia tyrosine kinase gene, BTK, is selectively down-regulated in T lymphocytes and plasma cells. The Journal of Immunology. 152(2): 557-65.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items