Quick Order

Human ERP27 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ERP27cDNA Clone Product Information
Gene_bank_ref_id:BC030218
cDNA Size:822
cDNA Description:ORF Clone of Homo sapiens endoplasmic reticulum protein 27 kDa DNA.
Gene Synonym:PDIA8, C12orf46, ERP27
Species:Human
Vector:pCMV3-N-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name
Background

ERP27 contains 1 thioredoxin domain and is a noncatalytic member of the protein disulfide isomerase family. Protein disulfide isomerases (PDIs) constitute a family of structurally related enzymes which catalyze disulfide bonds formation, reduction, or isomerization of newly synthesized proteins in the lumen of the endoplasmic reticulum (ER). They act also as chaperones, and are, therefore, part of a quality-control system for the correct folding of the proteins in the same subcellular compartment. PDI has been found to have moderate effects (25-fold) on the rate of oxidative folding of proteins in vitro. Recombinant Human Protein Disulfide Isomerase is involved in disulphide-bond formation and isomerization, as well as the reduction of disulphide bonds in proteins. Recombinant PDI has been found to have moderate effects (25-fold) on the rate of oxidative folding of proteins in vitro. ERP27 is a widely expressed protein which localizes to the ER and may act as a protease, protein disulfide isomerase, thiol-disulfide oxidase or phospholipase. ERP27 doesn't contain a CXXC active site motif indicating that it is a catalytically redox-inactive member of the protein disulfide isomerase family.

References
  • Lamesch P, et al. (2007) hORFeome v3.1: a resource of human open reading frames representing over 10,000 human genes. Genomics. 89(3):307-15.
  • Ota T, et al. (2004) Complete sequencing and characterization of 21,243 full-length human cDNAs. Nat Genet. 36(1):40-5.
  • Alanen HI, et al. (2006) ERp27, a new non-catalytic endoplasmic reticulum-located human protein disulfide isomerase family member, interacts with ERp57. J Biol Chem. 281(44):33727-38.
  • Size / Price
    Catalog:HG13256-NY
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"