Quick Order

Human GMFB ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human GMFB cDNA Clone Product Information
Gene_bank_ref_id:BC005359
RefSeq ORF Size:465bp
cDNA Description:Full length Clone DNA of Homo sapiens glia maturation factor, beta with N terminal HA tag.
Gene Synonym:GMF, GMFB
Species:Human
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

GMFB is a nerve growth factor which belongs to the actin-binding proteins ADF family, GMF subfamily. GMFB is involved in nervous system development, angiogenesis and immune function. It is especially crucial for the nervous system. GMFB causes brain cell differentiation, stimulates neural regeneration and inhibits tumor cell proliferation. It contains 1 ADF-H domain and is phosphorylated after phorbol ester stimulation. GMFB overexpression in astrocytes results in the increase of BDNF production. GMFB expression is increased by exercise, thus BDNF is important for exercise-induction of BDNF.

References
  • Kim W, et al. (2011) Systematic and quantitative assessment of the ubiquitin-modified proteome. Mol Cell. 44(2):325-40.
  • Zaheer S, et al. (2011) Augmented expression of glia maturation factor in Alzheimer's disease. Neuroscience. 194:227-33.
  • Danielsen JM, et al. (2011) Mass spectrometric analysis of lysine ubiquitylation reveals promiscuity at site level. Mol Cell Proteomics. 10(3):M110.003590.
  • Size / Price
    Catalog: HG13244-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"