After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse EPHA2 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse EPHA2 cDNA Clone Product Information
Gene_bank_ref_id:NM_010139.2
RefSeq ORF Size:2934bp
cDNA Description:Full length Clone DNA of Mus musculus Eph receptor A2 with N terminal Myc tag.
Gene Synonym:Eck, Myk2, Sek2, Sek-2, AW545284, Epha2
Species:Mouse
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Human EphA1 / Eph Receptor A1 Protein (His Tag, ECD)Rat EphB3 / HEK2 / Eph Receptor B3 Protein (His Tag, ECD)Mouse Ephrin B3 / EFNB3 Protein (His Tag)Mouse EphB6 Protein (His Tag)Human EphA1 / Eph Receptor A1 Protein (Fc Tag)Mouse Ephrin B3 / EFNB3 Protein (ECD, Fc Tag)Mouse EphA3 Protein (aa 569-984)Rat EphA3 Protein (Fc Tag)Human Ephrin-A4 / EFNA4 Protein (Fc Tag)Human EphB2 Protein (His & Fc Tag)Human EphB4 / HTK Protein (Fc Tag)Human EphB4 / HTK Protein (His Tag)Human EphB4 / HTK ProteinHuman EphB6 / EphB6 Protein (Fc Tag)Human EphB6 / EphB6 ProteinHuman Ephrin-A3 / EFNA3 ProteinHuman Ephrin-A3 / EFNA3 Protein (His & Fc Tag)Human Ephrin-A5 / EFNA5 Protein (Fc Tag)Human Ephrin-A1 / EFNA1 Protein (His & Fc Tag)Human Ephrin-A5 / EFNA5 Protein (His Tag)Human EphB2 Protein (His Tag)Human Ephrin-B1 / EFNB1 Protein (His Tag)Human Ephrin-A1 / EFNA1 Protein (His Tag)Human Ephrin-B1 / EFNB1 Protein (His & Fc Tag)Human Ephrin-B2 / EFNB2 Protein (His & Fc Tag)Mouse EphA6 / EHK-2 Protein (His Tag)Human Ephrin-A3 / EFNA3 / EFL2 Protein (Fc Tag)Human Ephrin-A3 / EFNA3 Protein (His Tag)Human EphB6 / EphB6 Protein (His Tag)Mouse Ephrin-B2 / EFNB2 Protein (His Tag)Mouse Ephrin-B2 / EFNB2 Protein (Fc Tag)Human Ephrin-B2 / EFNB2 Protein (His Tag)Human EphA4 Protein (His Tag)Human EphA7 / EHK3 Protein (His Tag)Mouse Ephrin-A1 / EFNA1 Protein (Fc Tag)Mouse Ephrin-A1 / EFNA1 Protein (His Tag)Mouse Ephrin-A3 / EFNA3 Protein (His Tag)Mouse Ephrin-A4 / EFNA4 Protein (His Tag)Mouse Ephrin-A4 / EFNA4 Protein (Fc Tag)Mouse Ephrin-A5 / EFNA5 Protein (His Tag)Mouse Ephrin-A5 / EFNA5 Protein (Fc Tag)Mouse Ephrin-B1 / EFNB1 Protein (Fc Tag)Mouse Ephrin-B1 / EFNB1 Protein (His Tag)Mouse Ephrin-A2 / EFNA2 Protein (His Tag)Mouse EphA2 Protein (His Tag)Mouse EphA4 / HEK8 Protein (His Tag)Mouse EphA4 / HEK8 Protein (Fc Tag)Mouse EphB3 / HEK2 Protein (His Tag)Mouse EphB4 / HTK Protein (Fc Tag)Mouse EphB4 / HTK Protein (His Tag)Mouse EphA6 / EHK-2 Protein (Fc Tag)Mouse EphA7 / EHK-3 Protein (His Tag)Mouse Ephrin-A2 / EFNA2 ProteinHuman EphB1 / EPHT2 Protein (His Tag)Human EphA4 Protein (His & Fc Tag)Mouse EphB1 / EPHT2 Protein (His & GST Tag)Mouse EphB1 / EPHT2 Protein (His Tag)Mouse EphA3 Protein (His Tag)Mouse EphA1 / EPH receptor A1 Protein (His Tag)Rat EphA3 Protein (His Tag)Rat Ephrin-A5 / EFNA5 Protein (Fc Tag)Rat Ephrin-A5 / EFNA5 Protein (His Tag)Rat Ephrin-B1 / EFNB1 Protein (His Tag)Rat Ephrin-B2 / EFNB2 Protein (Fc Tag)Rhesus Ephrin-A5 / EFNA5 Protein (Fc Tag)Rat Ephrin-B2 / EFNB2 Protein (His Tag)Human EphA7 / EHK3 Protein (His & GST Tag)Rat Ephrin-B1 / EFNB1 Protein (Fc Tag)Rat Ephrin-A1 / EFNA1 Protein (His Tag)Human EphA4 / HEK8 Protein (aa 570-986, His & GST Tag)Rat EphA4 Protein (His Tag)Rhesus EphA4 Protein (Fc Tag)Rat EphA4 Protein (Fc Tag)Rhesus Ephrin-A5 / EFNA5 Protein (His Tag)Human EphB4 / HTK Protein (aa 563-987, His & GST Tag)Human EphB2 / Hek5 Protein (aa 570-987, His & GST Tag)Human EphB1 / EPHT2 Protein (aa 565-984, His & GST Tag)Human EphB3 / HEK2 Protein (aa 585-998, His & GST Tag)Human EphA2 Protein (aa 585-976, His & GST Tag)Rat Ephrin-B3 / EFNB3 Protein (His Tag)Cynomolgus EphB6 / EphB6 Protein (Fc Tag)Rat Ephrin-B3 / EFNB3 Protein (Fc Tag)Human EphA3 Protein (His Tag)Rhesus EphA4 Protein (His Tag)Human EphB2 / Hek5 ProteinRat EphA7 / EHK3 Protein (His Tag)Human EphA2 Protein (His Tag)Mouse EphB2 / Hek5 Protein (Fc Tag)Danio rerio (zebrafish) EFNB2A / Ephrin B2a Protein (Fc Tag)Danio rerio (zebrafish) EFNB2A / Ephrin B2a Protein (His Tag)Canine Ephrin-A5 / EFNA5 Protein (Fc Tag)Canine Ephrin-B2 / EFNB2 Protein (His Tag)Human Ephrin-B2 / EFNB2 ProteinRhesus EphB1 / EPHT2 Protein (Fc Tag)Mouse EphA3 Protein (aa 569-984, His & GST Tag)Canine Ephrin-B2 / EFNB2 Protein (Fc Tag)Rhesus EphB1 / EPHT2 Protein (His Tag)Mouse EphA3 Protein (Fc Tag)Mouse EphB2 / Hek5 Protein (His Tag)Rat EphA7 / Eph Receptor A7 Protein (Fc Tag)
Background

Eph receptor A2 (Ephrin type-A receptor 2 or EphA2) is a member of the ephrin receptor subfamily of the protein-tyrosine kinase family. The Eph receptors' corresponding family of ligands are the ephrins anchored to cell surfaces. The ephrins and Eph receptors are implicated as positional labels that may guide the development of neural topographic maps. They have also been found implicated in embryonic patterning, neuronal targeting, vascular development and adult neovascularization. The large family of ligands and receptors may make a major contribution to the accurate spatial patterning of connections and cell position in the nervous system. Furthermore, elevated expression of Eph receptors and ephrin ligands is associated with tumors and associated tumor vasculature, suggesting the Eph receptors and ephrin ligands also play critical roles in tumor angiogenesis and tumor growth. Unlike most Eph kinases, which are primarily expressed during development, EphA2 is primarily found in adult human epithelial cells. The cellular functions of EphA2 may be regulating cell growth, survival, migration, and angiogenesis.Unlike other receptor tyrosine kinases, ligand binding is not necessary for EphA2. Rather, the ligand appears to regulate EphA2 subcellular localization and its interactions with downstream adapter and signaling proteins. Eph receptor A2(EphA2) has been demonstrated to critically regulate tumor cell growth, migration and invasiveness. Eph receptor A2(EphA2) is frequently overexpressed and functionally altered in aggressive tumor cells, and that these changes promote metastatic character.

References
  • Flanagan JG, et al. (1998) The ephrins and Eph receptors in neural development. Annu Rev Neurosci. 21: 309-45.
  • Cheng N, et al. (2002) The ephrins and Eph receptors in angiogenesis. Cytokine Growth Factor Rev. 13(1): 75-85.
  • Pratt RL, et al. (2002) Activation of the EphA2 tyrosine kinase stimulates the MAP/ERK kinase signaling cascade. Oncogene. 21(50): 7690-9.
  • Jennifer Walker-Daniels, et al. (2003) Differential Regulation of EphA2 in Normal and Malignant Cells. Am J Pathol. 162(4): 1037-1042.
  • Size / Price
    Catalog: MG50586-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"