Quick Order

Human AZGP1 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human AZGP1 cDNA Clone Product Information
Gene_bank_ref_id:BC033830
RefSeq ORF Size:897bp
cDNA Description:Full length Clone DNA of Homo sapiens alpha-2-glycoprotein 1, zinc-binding with N terminal HA tag.
Gene Synonym:ZAG, ZA2G, AZGP1
Species:Human
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Alpha-2-glycoprotein, also known as AZGP1, belongs to the MHC class I family. It can be detected in body fluids such as serum, sweat, and seminal and breast cyst fluids. It has been shown that alpha-2-glycoprotein can stimulate lipolysis by adipocytes in vivo and in vitro. Thus it is believed that alpha-2-glycoprotein plays an important role in the regulation of body weight, and age-dependent changes in genetically influenced obesity, and it also regulates melanin production by normal and malignant melanocytes. Alpha-2-glycoprotein is produced by both white and brown fat adipocytes and may act in a local autocrine fashion in the reduction of adiposity in cachexia.

References
  • Tada T, et al. (1991) Immunohistochemical localization of Zn-alpha 2-glycoprotein in normal human tissues. J Histochem Cytochem. 39(9):1221-6.
  • Vanni H, et al. (2009) Cigarette Smoking Induces Overexpression of a Fat-Depleting Gene AZGP1 in the Human. Chest. 135(5):1197-208.
  • Ueyama H, et al. (1991) Cloning and nucleotide sequence of a human Zn-alpha 2-glycoprotein cDNA and chromosomal assignment of its gene. Biochem Biophys Res Commun. 177(2):696-703.
  • Size / Price
    Catalog: HG13242-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"