After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Human AHSP / ERAF Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
AHSPcDNA Clone Product Information
cDNA Size:309
cDNA Description:ORF Clone of Homo sapiens erythroid associated factor DNA.
Gene Synonym:EDRF, ERAF, AHSP
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human AHSP / ERAF Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged on other vectors
Related Products
Product nameProduct name

AHSP, also known as ERAF, is a conserved mammalian erythroid protein which belongs to the AHSP family. It is expressed in blood and bone marrow. AHSP facilitates the production of Hemoglobin A by stabilizing free α-globin. It rapidly binds to ferrous α with association (k'(AHSP)) and dissociation (k(AHSP)) rate constants of ≈10 μm(-1) s(-1) and 0.2 s(-1), respectively, at pH 7.4 at 22 ℃. A small slow phase was observed when AHSP binds to excess ferrous αCO. This slow phase appears to be due to cis to trans prolyl isomerization of the Asp(29)-Pro(30) peptide bond in wild-type AHSP because it was absent when αCO was mixed with P30A and P30W AHSP, which are fixed in the trans conformation. This slow phase was also absent when met(Fe(3+))-α reacted with wild-type AHSP, suggesting that met-α is capable of rapidly binding to either Pro(30) conformer. Both wild-type and Pro(30)-substituted AHSPs drive the formation of a met-α hemichrome conformation following binding to either met- or oxy(Fe(2+))-α. The dissociation rate of the met-α·AHSP complex (k(AHSP) ≈ 0.002 s(-1)) is ~100-fold slower than that for ferrous α·AHSP complexes, resulting in a much higher affinity of AHSP for met-α. Thus, in vivo, AHSP acts as a molecular chaperone by rapidly binding and stabilizing met-α hemichrome folding intermediates. The low rate of met-α dissociation also allows AHSP to have a quality control function by kinetically trapping ferric α and preventing its incorporation into less stable mixed valence Hemoglobin A tetramers. Reduction of AHSP-bound met-α allows more rapid release to β subunits to form stable fully, reduced hemoglobin dimers and tetramers.