After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human TYRP1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
TYRP1cDNA Clone Product Information
Gene_bank_ref_id:NM_000550.2
cDNA Size:1614
cDNA Description:ORF Clone of Homo sapiens tyrosinase-related protein 1 DNA.
Gene Synonym:TRP, CAS2, CATB, GP75, TYRP, b-PROTEIN, TYRP1
Species:Human
Vector:pCMV3-N-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name
Background

Tyrosinase-related protein 1, also known as TYRP1 or TRP1, is a melanosomal enzyme that belongs to the tyrosinase family and plays an important role in the melanin biosynthetic pathway. Mutations in this enzyme are the cause of rufous oculocutaneous albinism and oculocutaneous albinism type III. TYRP1 / TRP1 is involved in the oxidation of 5,6-dihydroxyindole-2-carboxylic acid (DHICA) into indole-5,6-quinone-2-carboxylic acid. This enzyme may regulate or influence the type of melanin synthesized. The expression of Tyrosinase-related protein 1 (TYRP1) is regulated by the microphthalmia-associated transcription factor (MITF). There is mounting evidence demonstrating that in addition to its role in eumelanin synthesis, TYRP1 is involved in maintaining stability of tyrosinase proliferation and melanocyte cell death.

References
  • Sarangarajan R, et al. (2001) Tyrp1 and oculocutaneous albinism type 3. Pigment Cell Res. 14(6): 437-44.
  • Box NF, et al. (1998) Complete sequence and polymorphism study of the human TYRP1 gene encoding tyrosinase-related protein 1. Genome. 9 (1): 50-3.
  • Size / Price
    Catalog:HG13224-NY
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"