Quick Order

Human SERPINB3 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SERPINB3 cDNA Clone Product Information
NCBI RefSeq:NM_006919.2
RefSeq ORF Size:1173bp
cDNA Description:Full length Clone DNA of Homo sapiens serpin peptidase inhibitor, clade B (ovalbumin), member 3 with N terminal HA tag.
Gene Synonym:SCC, T4-A, SCCA1, SCCA-1, HsT1196, SCCA-PD, SERPINB3
Species:Human
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

SERPINB3, also known as SCCA-1, belongs to the serpin family. Serpins are a group of proteins with similar structures that were first identified as a set of proteins able to inhibit proteases. The acronym serpin was originally coined because many serpins inhibit chymotrypsin-like serine proteases. SERPINB3 is expressed in some hepatocellular carcinoma (at protein level). Its expression is closely related to cellular differentiation in both normal and malignant squamous cells. It seems to also be secreted in plasma by cancerous cells but at a low level. SERPINB3 significantly attenuates apoptosis by contrasting cytochrome c release from the mitochondria and by antichemotactic effect for NK cells. It may act as a protease inhibitor to modulate the host immune response against tumor cells and may be involved in the malignant behavior of squamous cell carcinoma cells.

References
  • Schneider SS, et al. (1995) A serine proteinase inhibitor locus at 18q21.3 contains a tandem duplication of the human squamous cell carcinoma antigen gene. Proc Natl Acad Sci. 92(8):3147-51.
  • Suminami Y, et al.. (1992) Squamous cell carcinoma antigen is a new member of the serine protease inhibitors. Biochem Biophys Res Commun. 181(1):51-8.
  • Mino-Miyagawa N, et al. (1990) Tumor-antigen 4. Its immunohistochemical distribution and tissue and serum concentrations in squamous cell carcinoma of the lung and esophagus. Cancer. 66(7):1505-12.
  • Size / Price
    Catalog: HG13218-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"