Quick Order

Mouse SERPINB9 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SERPINB9cDNA Clone Product Information
Gene_bank_ref_id:NM_009256.3
cDNA Size:1125
cDNA Description:ORF Clone of Mus musculus serine (or cysteine) peptidase inhibitor, clade B, member 9 DNA.
Gene Synonym:PI9, CAP3, PI-9, Spi6, CAP-3, BB283241, ovalbumin, Serpinb9
Species:Mouse
Vector:pCMV3-N-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-Myc Vector Information
 
Vector Name pCMV3-N-Myc
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-N-Myc Physical Map

Schematic of pCMV3-N-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Mouse SERPINB9 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged on other vectors
Related Products
Product nameProduct name
Background

SerpinB9, also known as Cytoplasmic antiproteinase 3, CAP-3, Peptidase inhibitor 9, SERPINB9 and PI-9, is a cytoplasm protein which belongs to the serpin family and Ov-serpin subfamily. Serpin-B9 ( CAP-3 / PI-9 ) is the only known human intracellular inhibitor of granzyme B (GrB), the effector molecule in immunity against cytomegalovirus (CMV) and in renal allograft rejection. Serpin-B9 and SPI-6 expression in immune-privileged cells, APCs, and CTLs protects these cells against the actions of granzyme B, and when expressed in tumor cells or virally infected hepatocytes, confers resistance to killing by CTL and NK cells. Expression of increasing levels of Serpin-B9 ( CAP-3 / PI-9 ) in target cells may progressively inhibit immune surveillance by blocking NK and CTL-induced cytotoxicity through the perforin / granzyme pathway and then through the Fas / FasL pathway. Serpin-B9 ( CAP-3 / PI-9 ) is selectively up-regulated in hepatocytes in response to infiltration of the liver by NK cells that express perforin and enzymatically active granzyme B. Upregulated expression of Serpin-B9 ( CAP-3 / PI-9 ) in NSCLC cells may serve to protect them from apoptosis induced by GrB.

References
  • Rowshani,A.T. et al., 2005, J Infect Dis.192 (11): 1908-11.
  • Cunningham,T.D. et al., 2007, Cell Immunol 245 (1): 32-41.
  • Rousalova,I. et al., 2010, Int J Oncol  36 (1): 275-83.
  • Stout-Delgado,H.W. et al., 2007, J Immunol. 179 (10):6561-7.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"