Quick Order

Text Size:AAA

Mouse FAM19A2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
FAM19A2cDNA Clone Product Information
Gene_bank_ref_id:NM_182807.2
cDNA Size:408
cDNA Description:ORF Clone of Mus musculus family with sequence similarity 19, member A2 DNA.
Gene Synonym:TAFA2, Tafa-2, AI851790, 6330575M02, FAM19A2TAFA-2, Fam19a2
Species:Mouse
Vector:pCMV3-N-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-Myc Vector Information
 
Vector Name pCMV3-N-Myc
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-N-Myc Physical Map

Schematic of pCMV3-N-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Mouse FAM19A2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged on other vectors
Chemokine & Receptor Related Products
Product nameProduct name
Background

FAM19A2 belongs to the FAM19/TAFA family. FAM19/TAFA family members are chemokine-like proteins. The biological functions of TAFA family members remain to be determined, but there are a few tentative hypotheses. First, TAFAs may modulate immune responses in the CNS by functioning as brain specific chemokines, and may act with other chemokines to optimize the recruitment and activity of immune cells in the CNS. Second, TAFAs may represent a novel class of neurokines that act as regulators of immune nervous cells. And third, TAFAs may control axonal sprouting following brain injury. Human FAM19A2 is 97% aa identical to mouse FAM19A2 and is expressed in the central nervous system (CNS), colon, heart, lung, spleen, kidney, and thymus, however its expression in the CNS is 50 to 1000 fold higher than in other tissues. FAM19A2 gene is a member of the TAFA family which is composed of five highly homologous genes that encode small secreted proteins.

References
  • Parsa A, et al. (2011) Hypertrophy-associated polymorphisms ascertained in a founder cohort applied to heart failure risk and mortality. Clin Transl Sci. 4(1):17-23.
  • Rose JE, et al. (2010) Personalized smoking cessation: interactions between nicotine dose, dependence and quit-success genotype score. Mol Med. 16(7-8):247-53.
  • Trynka G, et al. (2009) Coeliac disease-associated risk variants in TNFAIP3 and REL implicate altered NF-kappaB signalling. Gut. 58(8):1078-83.
  • Size / Price
    Catalog:MG50554-NM
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"