Quick Order

Human CYGB Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CYGBcDNA Clone Product Information
Gene_bank_ref_id:BC029798
cDNA Size:573
cDNA Description:ORF Clone of Homo sapiens cytoglobin DNA.
Gene Synonym:HGB, STAP, CYGB
Species:Human
Vector:pCMV3-C-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
 
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name
Background

Cytoglobin, also known as CYGB, is a globin molecule ubiquitously expressed in all tissues and most notably utilized in marine mammals. Its avtual function is still unknown. It is thought to be a method of protection under conditions of hypoxia. The predicted function of cytoglobin is the transfer of oxygen from arterial blood to the brain. Cytoglobin is also present in chondroblasts and osteoblasts and shows a decreased level of expression upon differentiation to chondrocytes and osteocytes. Cytoglobin may facilitate diffusion of oxygen through tissues, scavenge nitric oxide or reactive oxygen species, or serve a protective function during oxidative stress.

References
  • Burmester T. et al., 2002, Mol Biol Evol. 19 (4): 416-21.
  • Trent JT. et al., 2002, J Biol Chem. 277 (22): 19538-45.
  • Kawada N. et al., 2001, J Biol Chem. 276 (27): 25318-23.
  • Schmidt M. et al., 2004, J Biol Chem. 279 (9): 8063-9.
  • Size / Price
    Catalog:HG14367-CY
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"