After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse ACHE ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse ACHE cDNA Clone Product Information
Gene_bank_ref_id:NM_009599.3
RefSeq ORF Size:1844bp
cDNA Description:Full length Clone DNA of Mus musculus acetylcholinesterase with N terminal Myc tag.
Gene Synonym:mE1a, mE1b, mE1c, mE1d, mE1e, mE1d', mE1c-long, Ache
Species:Mouse
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Acetylcholinesterase, also known as ACHE, is an enzyme that degrades (through its hydrolytic activity) the neurotransmitter acetylcholine, producing choline and an acetate group. Acetylcholinesterase plays a crucial role in nerve impulse transmission at cholinergic synapses by rapid hydrolysis of the neurotransmitter acetylcholine (ACh). ACHE appears to be a potential therapeutic target at muscle injuries including organophosphate myopathy. It is an externally oriented membrane-bound enzyme and its main physiological role is termination of chemical transmission at cholinergic synapses and secretory organs by rapid hydrolysis of the neurotransmitter acetylcholine (ACh). ACHE plays important roles in the cholinergic system, and its dysregulation is involved in a variety of human diseases. ACHE was significantly down-regulated in the cancerous tissues of 69.2% of hepatocellular carcinoma (HCC) patients, and the low ACHE expression in HCC was correlated with tumor aggressiveness, an elevated risk of postoperative recurrence, and a low survival rate. Both the recombinant ACHE protein and the enhanced expression of ACHE significantly inhibited HCC cell growth in vitro and tumorigenicity in vivo. ACHE as a tumor growth suppressor in regulating cell proliferation, the relevant signaling pathways, and the drug sensitivity of HCC cells. Thus, ACHE is a promising independent prognostic predictor for HCC recurrence and the survival of HCC patients. ACHE is responsible for the hydrolysis of acetylcholine in the nervous system. It is inhibited by organophosphate and carbamate pesticides. However, this enzyme is only slightly inhibited by organophosphorothionates.

References
  • Zhao Y, et al. (2011) Acetylcholinesterase, a key prognostic predictor for hepatocellular carcinoma, suppresses cell growth and induces chemosensitization. Hepatology. 53(2): 493-503.
  • Roepcke CB, et al. (2010) Analysis of phosphorothionate pesticides using a chloroperoxidase pretreatment and acetylcholinesterase biosensor detection. J Agric Food Chem. 58(15): 8748-56.
  • Zaheer-ul-Haq, et al. (2010) Benchmarking docking and scoring protocol for the identification of potential acetylcholinesterase inhibitors. J Mol Graph Model. 28(8): 870-82.
  • Pegan K, et al. (2010) Acetylcholinesterase is involved in apoptosis in the precursors of human muscle regeneration. Chem Biol Interact. 187(1-3): 96-100.
  • Size / Price
    Catalog: MG50543-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"