After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human STAT6 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
STAT6cDNA Clone Product Information
cDNA Size:2544
cDNA Description:ORF Clone of Homo sapiens signal transducer and activator of transcription 6 DNA.
Gene Synonym:D12S1644, IL-4-STAT, STAT6B, STAT6C, STAT6
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-HA Vector Information
Vector Name pCMV3-N-HA
Vector Size 6101bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-HA Physical Map
Schematic of pCMV3-N-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

Signal transducer and activator of transcription 6 (STAT6) is a transcription factor that is activated by interleukin-4 (IL-4)-induced tyrosine phosphorylation and mediates most of the IL-4-induced gene expression. STAT6 plays a central role in exerting interleukin-4 (IL-4) mediated biological responses and is found to induce the expression of BCL2L1/BCL-XL, which is responsible for the anti-apoptotic activity of IL4. Transcriptional activation by STAT6 requires the interaction with coactivators like p300 and the CREB-binding protein (CBP). NF-?B and tyrosine-phosphorylated Stat6 can directly bind each other in vitro and in vivo, which suggest that the direct interaction between Stat6 and NF-?B may provide a basis for synergistic activation of transcription by IL-4 and activators of NF-?B. 

  • Litterst CM, et al. (2001) Transcriptional activation by STAT6 requires the direct interaction with NCoA-1. J Biol Chem. 276 (49): 45713-21.
  • Stutz AM, et al. (1999) Functional synergism of STAT6 with either NF-kappa B or PU.1 to mediate IL-4-induced activation of IgE germline gene transcription. J Immunol. 163 (8): 4383-91.
  • Yang J, et al. (2002) Identification of p100 as a coactivator for STAT6 that bridges STAT6 with RNA polymerase II. EMBO J. 21 (18): 4950-8.