Quick Order

Human FCRL6 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human FCRL6 cDNA Clone Product Information
Gene_bank_ref_id:NM_001004310.2
RefSeq ORF Size:1305bp
cDNA Description:Full length Clone DNA of Homo sapiens Fc receptor-like 6 with C terminal His tag.
Gene Synonym:FcRH6
Species:Human
Vector:pCMV3-C-His
Plasmid:pCMV3-FCRL6-His
Restriction Site:KpnI + XbaI (6kb + 1.35kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Size / Price
Catalog: HG16091-CH
List Price:   (Save )
Price:      [How to order]
AvailabilityIn StockShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"