After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human TPPP3 ORF mammalian expression plasmid, C-HA tag

DatasheetReviewsRelated ProductsProtocols
Human TPPP3 cDNA Clone Product Information
NCBI RefSeq:BC000691
RefSeq ORF Size:531bp
cDNA Description:Full length Clone DNA of Homo sapiens tubulin polymerization-promoting protein family member 3 with C terminal HA tag.
Gene Synonym:CGI-38, p20, p25gamma, TPPP3
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

TPPP3, a member of the Tubulin polymerization-promoting protein family, is an intrinsically unstructured protein that induces tubulin polymerization. TPPP3 is a marker in the developing musculoskeletal system. In tendons, Tppp3 is expressed in cells at the circumference of the developing tendons, likely the progenitors of connective tissues that surround tendons: the tendon sheath, epitenon, and paratenon. Tppp3 is also expressed in forming synovial joints. The onset of Tppp3 expression in joints coincides with cavitation, representing a molecular marker that can be used to indicate this stage in joint transition in joint differentiation. In late embryonic stages, Tppp3 expression highlights other demarcation lines that surround differentiating tissues in the forelimb.

Depletion of TPPP3 by microRNA-based RNA interference (RNAi) inhibits cell growth, arrests cell cycles, and causes mitotic abnormalities in HeLa cells. C57BL/6 mice that received subcutaneously injected LLC (Lewis lung carcinoma) cells in which TPPP3 was knocked down showed a pronounced reduction in tumor progression. The migration/invasion activity of TPPP3-knockdown LLC cells was significantly suppressed in a transwell chamber migration assay. When these cells were injected into the tail veins of C57BL/6 mice, they exhibited milder lung metastasis compared with control tumor cells. Taken together, these findings suggested that the TPPP3 gene played an important role in tumorigenesis and metastasis, and it could potentially become a novel target for cancer therapy.

References
  • Staverosky JA, et al. (2009) Tubulin polymerization-promoting protein family member 3, Tppp3, is a specific marker of the differentiating tendon sheath and synovial joints. Dev Dyn. 238(3):685-92.
  • Zhou W, et al. (2010) Stable knockdown of TPPP3 by RNA interference in Lewis lung carcinoma cell inhibits tumor growth and metastasis. Mol Cell Biochem. 343(1-2):231-8.
  • Size / Price
    Catalog: HG14360-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"