Quick Order

Human CCDC134 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CCDC134 cDNA Clone Product Information
Gene_bank_ref_id:NM_024821.2
RefSeq ORF Size:690bp
cDNA Description:Full length Clone DNA of Homo sapiens coiled-coil domain containing 134 with N terminal HA tag.
Gene Synonym:FLJ22349, MGC21013, dJ821D11.3, CCDC134
Species:Human
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Human coiled-coil domain containing 134 (CCDC134) is a 229 amino acids secretory protein. Coiled-coil domain is a motif in which alpha-helix are coiled together. It has been found in many types of proteins, including transcription factors, intermediate filaments and certain tRNA synthetases. Many proteins containing such motif CCDC134 are involved in important biological functions. CCDC134 is also considered as a novel human MAPK-regulating protein that can inhibit the MAPK pathway. This protein significantly inhibite Elk1 transcriptional activity. The coiled-coil domain is a ubiquitous protein motif that is often involved in oligomerization.

References
  • Huang J, et al. (2007) CCDC134, a novel secretory protein, inhibits activation of ERK and JNK, but not p38 MAPK. Cellular and Molecular Life Sciences. 65(2): 338-49.
  • Kim S, et al. (2011) Genome-wide association study of CSF biomarkers Abeta1-42, t-tau, and p-tau181p in the ADNI cohort. Neurology. 76(1): 69-79.
  • Size / Price
    Catalog: HG13168-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"