Quick Order

Human CARHSP1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CARHSP1cDNA Clone Product Information
cDNA Size:444
cDNA Description:ORF Clone of Homo sapiens calcium regulated heat stable protein 1, 24kDa DNA.
Gene Synonym:CRHSP-24, CSDC1, MGC111446, CARHSP1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human CARHSP1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged on other vectors
Related Products
Product nameProduct name

CARHSP1 is a biomarker for diabetic complications. Adenovirus-mediated CARHSP1 overexpression and siRNA-mediated knockdown experiments were performed to characterize the role of CARHSP1 in the regulation of gluconeogenic gene expression. CARHSP1 is regulated by nutrient status in the liver and functions at the transcriptional level to negatively regulate gluconeogenic genes, including the glucose-6-phosphatase catalytic subunit (G6Pc) and phosphoenolpyruvate carboxykinase 1 (PEPCK1). In addition, it is found that CARHSP1 can physically interact with peroxisome proliferator-activated receptor-α (PPARα) and inhibit its transcriptional activity. Both pharmacological and genetic ablations of PPARα attenuate the inhibitory effect of CARHSP1 on gluconeogenic gene expression in hepatocytes.

  • Wistow G. et al., 2002, Mol Vis. 8: 205-20.
  • Wishart MJ. et al., 2002, Proc Natl Acad Sci. 99 (4): 2112-7.
  • Groblewski GE. et al., 1998, J Biol Chem. 273 (35): 22738-44.
  • Fan Y. et al., 2011, J Biol Chem. 286 (47): 40584-94.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items