After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human BLVRB Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
BLVRBcDNA Clone Product Information
cDNA Size:621
cDNA Description:ORF Clone of Homo sapiens biliverdin reductase B (flavin reductase (NADPH)) DNA.
Gene Synonym:FLR, BVRB, SDR43U1, MGC117413, BLVRB
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-HA Vector Information
Vector Name pCMV3-N-HA
Vector Size 6101bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-HA Physical Map
Schematic of pCMV3-N-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

Biliverdin reductase (hBVR) is a serine/threonine kinase that catalyzes reduction of the heme oxygenase (HO) activity product, biliverdin, to bilirubin. BVR consists of an N-terminal dinucleotide-binding domain (Rossmann-fold) and a C-terminal domain that contains a six-stranded β-sheet that is flanked on one face by several α-helices. The C-terminal and N-terminal domains interact extensively, forming the active site cleft at their interface. Biliverdin reductase (BVR) catalyzes the last step in heme degradation by reducing the γ-methene bridge of the open tetrapyrrole, biliverdin IXα, to bilirubin with the concomitant oxidation of a β-nicotinamide adenine dinucleotide (NADH) or β-nicotinamide adenine dinucleotide phosphate (NADPH) cofactor. It is now recognized that human BVR (hBVR) is a dual-specificity kinase (Ser / Thr and Tyr) upstream activator of the insulin/insulin growth factor-1 (IGF-1) and mitogen-activated protein kinase (MAPK) signaling pathways. Human BVR (hBVR) is essential for MAPK-extracellular signal-regulated kinase (ERK)1/2 (MEK)-eukaryotic-like protein kinase (Elk) signaling and has been identified as the cytoplasm-nuclear heme transporter of ERK1/2 and hematin, the key components of stress-responsive gene expression.

  • Kapitulnik J, et al. (2009) Pleiotropic functions of biliverdin reductase: cellular signaling and generation of cytoprotective and cytotoxic bilirubin. Trends in Pharmacological Sciences. 30(3): 129-37.
  • Ahmad Z, et al. (2002) Human Biliverdin Reductase Is a Leucine Zipper-like DNA-binding Protein and Functions in Transcriptional Activation of Heme Oxygenase-1 by Oxidative Stress. The Journal of Biological Chemistry. 277: 9226-32.
  • Whitby FG, et al. (2002) Crystal Structure of a Biliverdin IX Reductase Enzyme-Cofactor Complex. Journal of Molecular Biology. 319(5): 1199-210.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks