After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human LRIG1 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human LRIG1 cDNA Clone Product Information
Gene_bank_ref_id:NM_015541.2
RefSeq ORF Size:3282bp
cDNA Description:Full length Clone DNA of Homo sapiens leucine-rich repeats and immunoglobulin-like domains 1 with C terminal His tag.
Gene Synonym:LIG1, LIG-1
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Human NRG1 Protein (His Tag, ECD)Mouse EGFL6 / EGF-L6 Protein (His Tag)Mouse EGFL6 / EGF-L6 Protein (Fc Tag)Human TMEFF1 / Tomoregulin-1 Protein (Fc Tag, ECD)Rhesus EGFR / HER1 / ErbB1 Protein (ECD, Fc Tag)Human HER2 / ErbB2 ProteinHuman EGFL6 / EGF-L6 Protein (Flag & His Tag)Human HER2 / ErbB2 Protein (ECD, domain IV) (His Tag)Mouse EGF / Epidermal growth factor Protein (His Tag)Rhesus HER3 / ErbB3 ProteinHuman HER3 / ErbB3 ProteinRhesus EGFR / HER1 / ErbB1 Protein (ECD, His Tag)Cynomolgus HER2 / ErbB2 Protein (ECD, Fc Tag)Human EGFR / HER1 / ErbB1 (aa 668-1210) Protein (His & GST Tag)Human NRG1 Protein (Fc Tag)Human / Rhesus HER4 / ErbB4 Protein (His Tag)Cynomolgus HER2 / ErbB2 Protein (His Tag)Human EGFR / HER1 / ErbB1 Protein (His Tag)Human HER2 / ErbB2 Protein (Fc Tag)Human HER3 / ErbB3 Protein (Fc Tag)Human HER4 / ErbB4 Protein (His & Fc Tag)Human EGFR / HER1 / ErbB1 Protein (Fc Tag)Human EGF / Epidermal Growth Factor Protein (Fc Tag)Human HER2 / ErbB2 Protein (His Tag)Mouse BTC / Betacellulin Protein (His & Fc Tag)Human HER3 / ErbB3 Protein (His Tag)Human EGFR / HER1 / ErbB1 Protein (His Tag)Human EGF / Epidermal Growth Factor ProteinHuman EGFL7 / VE-statin Protein (His Tag)Rat HER2 / ErbB2 ProteinRat HER2 / ErbB2 Protein (Fc Tag)Rat HER2 / ErbB2 Protein (His Tag)Rhesus HER2 / ErbB2 Protein (Fc Tag)Rhesus HER2 / ErbB2 Protein (His Tag)Mouse Epiregulin / EREG Protein (Fc Tag)Human Epiregulin / EREG Protein (Fc Tag)Mouse EGFL7 / VE-statin Protein (His Tag)Human HBEGF / DTR ProteinMouse LRIG1 / LIG-1 Protein (His Tag)Mouse EGF / Epidermal Growth Factor Protein (Fc Tag)Mouse HER2 / ErbB2 / CD340 Protein (His Tag)Mouse HER3 / ErbB3 Protein (His Tag)Mouse HER2 / ErbB2 Protein (Fc Tag)Rhesus HER3 / ErbB3 Protein (His Tag)Rhesus HER3 / ErbB3 Protein (Fc Tag)Canine EGF / Epidermal Growth Facto Protein (His Tag)Human HER2 / ErbB2 Protein (ECD, domain I) (His Tag)Human NRG1-beta 1 Protein (EGF Domain, Fc Tag)Mouse EGFR / HER1 / ErbB1 Protein (Fc Tag)Mouse EGFR / HER1 / ErbB1 Protein (His Tag)Human HER2 / ErbB2 / CD340 (676-1255) Protein (His & GST Tag)Human NRG1-beta 1 Protein (ECD, Fc Tag)Human NRG4 ProteinHuman NRG1-alpha Protein (EGF Domain, Fc Tag)Human NRG1-alpha Protein (ECD, Fc Tag)Human NRG1-alpha Protein (ECD, His Tag)Human / Rhesus HER4 / ErbB4 Protein (His Tag)Human / Rhesus HER4 / ErbB4 Protein (Fc Tag)Human HER3 / ErbB3 Protein (aa 730-1065, His & GST Tag)Human NRG1-beta 1 Protein (ECD, Fc Tag)Rat EGFR / HER1 / ErbB1 Protein (His Tag)Human NRG1-beta 1 Protein (ECD)Mouse HER4 / ErbB4 Protein (His Tag)Rat HER3 / ErbB3 Protein (Fc Tag)Rat HER3 / ErbB3 Protein (His Tag)Rat HER4 / ErbB4 Protein (Fc Tag)Human BTC / Betacellulin Protein (Fc Tag)Cynomolgus BTC / Betacellulin Protein (Fc Tag)Mouse EGF / Epidermal Growth Factor ProteinCanine HER2 / ErbB2 Protein (His Tag)Canine EGFR / HER1 / ErbB1 Protein (His Tag)Human HER3 / ErbB3 Protein (Fc Tag)Human BTC / Betacellulin ProteinMouse EGF / Epidermal Growth Factor ProteinHuman EGFL6 / EGF-L6 Protein (His Tag)Rat HER4 / ErbB4 Protein (His Tag)Canine NRG1-alpha Protein (EGF Domain, Fc Tag)Canine NRG1-alpha Protein (ECD, His Tag)Canine NRG1-alpha Protein (ECD, Fc Tag)Human TGFA / TGF-alpha ProteinCanine NRG1-alpha Protein (ECD)Rhesus EGFR / HER1 / ErbB1 Protein (His Tag, ECD)Mouse TMEFF1 / Tomoregulin-1 Protein (Fc Tag)Rat EGF / Epidermal Growth Factor ProteinCanine NRG1 Protein (His Tag)
References
  • Shattuck DL, et al. (2007) LRIG1 Is a Novel Negative Regulator of the Met Receptor and Opposes Met and Her2 Synergy. Mol Cell Biol. 27 (5): 1934-46.
  • Ledda F, et al. (2008) Lrig1 is an endogenous inhibitor of Ret receptor tyrosine kinase activation, downstream signaling, and biological responses to GDNF. J Neurosci. 28(1): 39-49.
  • Hedman H, et al. (2002) Is LRIG1 a tumour suppressor gene at chromosome 3p14.3 Acta Oncol. 41(4): 352-4.
  • Size / Price
    Catalog: HG16060-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"