After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human AK2 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human AK2 cDNA Clone Product Information
Gene_bank_ref_id:BC009405
RefSeq ORF Size:720bp
cDNA Description:Full length Clone DNA of Homo sapiens adenylate kinase 2 with N terminal HA tag.
Gene Synonym:ADK2, AK2, AK2
Species:Human
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Adenylate kinase 2 (AK2) belongs to the Adenylate kinase family that contains three isozymes: AK1, AK2 and AK3. Adenylate kinases are involved in regulating the adenine nucleotide composition within a cell by catalyzing the reversible transfer of phosphate groups among adenine nucleotides. Adenylate kinase2 (AK2) is expressed in mitochondrial intermembrane space. It may play a role in apoptosis. It has been demonstrated that in apoptotic cells AK2 was translocated into the cytosol concomitantly with cytochronme C. Mutations in this gene are the cause of reticular dysgenesis. These mutations result in absent or strongly decreased protein expression. It has been also established that AK2 is specifically expressed in the stria vascularis region of the inner ear, which provides an explanation of the sensorineural deafness in these individuals. 

References
  • Lagresle-Peyrou C, et al. (2008) Human adenylate kinase 2 deficiency causes a profound hematopoietic defect associated with sensorineural deafness. Nature Genetics. 41: 106-11.
  • Bruns GA, et al. (1977) Adenylate kinase 2, a mitochondrial enzyme. Biochem Genet. 15 (5-6): 477-86.
  • Khler C, et al. (1999) Release of adenylate kinase 2 from the mitochondrial intermembrane space during apoptosis. FEBS Lett. 447 (1): 10-2.
  • Size / Price
    Catalog: HG13146-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"