Quick Order

Text Size:AAA

Mouse CTLA4 ORF mammalian expression plasmid, N-Myc tag

DatasheetReviewsRelated ProductsProtocols
Mouse CTLA4 cDNA Clone Product Information
NCBI RefSeq:NM_009843.3
RefSeq ORF Size:654bp
cDNA Description:Full length Clone DNA of Mus musculus cytotoxic T-lymphocyte-associated protein 4 with N terminal Myc tag.
Gene Synonym:Cd152, Ly-56, Ctla-4, Ctla4
Species:Mouse
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Cytotoxic T-lymphocyte protein 4, also known as CTLA4 and CD152, is a single-pass type I membrane protein and a member of the immunoglobulin superfamily. It is the second member of the CD28 receptor family. The ligands or counterreceptors for these two proteins are the B7 family members, CD80 (B7-1) and CD86 (B7-2). CTLA4 transmits an inhibitory signal to T cells, whereas CD28 transmits a stimulatory signal. Intracellular CTLA4 is also found in regulatory T cells and may play an important role in their functions. CD152 or cytotoxic T lymphocyte antigen-4 (CTLA-4) is an essential receptor involved in the negative regulation of T cell activation. Because of its profound inhibitory role, CD152 has been considered a sound susceptible candidate in autoimmunity and a persuasive target for cancer immunotherapy. In particular, recent evidence suggests that CD152 is also important in the homeostasis and function of a population of suppressive cells, termed regulatory T cells (Treg).

References
  • Slavik JM, et al. (1999) CD28/CTLA-4 and CD80/CD86 families: signaling and function. Immunol Res. 19(1): 1-24.
  • Holmberg D, et al. (2005) CTLA-4 (CD152) and its involvement in autoimmune disease. Autoimmunity. 38(3): 225-33.
  • Chin LT, et al. (2008) Immune intervention with monoclonal antibodies targeting CD152 (CTLA-4) for autoimmune and malignant diseases. Chang Gung Med J. 31(1): 1-15.
  • Size / Price
    Catalog: MG50503-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"