Quick Order

Text Size:AAA

Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb2 (Codon Optimized) ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
H9N2 PB2 cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:2280bp
cDNA Description:Full length Clone DNA of Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb2 with C terminal Myc tag.
Gene Synonym:PB2
Species:H9N2
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with AGE15505.1.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb2 (Codon Optimized) ORF mammalian expression plasmid, C-Myc tag on other vectors
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb2 ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark tagVG40364-ACG$345
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb2 (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40364-ACR$345
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb2 ORF mammalian expression plasmid, N-GFPSpark tagVG40364-ANG$345
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb2 (Codon Optimized) ORF mammalian expression plasmid, N-OFPSpark / RFP tagVG40364-ANR$345
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb2 ORF mammalian expression plasmid (Codon Optimized), C-FLAG-taggedVG40364-CF$315
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb2 (Codon Optimized) ORF mammalian expression plasmid, C-His tagVG40364-CH$315
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb2 (Codon Optimized) ORF mammalian expression plasmid, C-Myc tagVG40364-CM$315
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb2 (Codon Optimized) ORF mammalian expression plasmid, C-HA tagVG40364-CY$315
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb2 ORF mammalian expression plasmid (Codon Optimized)VG40364-G$195
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb2 (Codon Optimized) ORF mammalian expression plasmid, N-Flag tagVG40364-NF$315
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb2 (Codon Optimized) ORF mammalian expression plasmid, N-His tagVG40364-NH$315
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb2 (Codon Optimized) ORF mammalian expression plasmid, N-Myc tagVG40364-NM$315
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb2 (Codon Optimized) ORF mammalian expression plasmid, N-HA tagVG40364-NY$315
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb2 ORF mammalian expression plasmid (Codon Optimized)VG40364-UT$315
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: VG40364-CM
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"