After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS3 ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
WNV WNV-NS3 cDNA Clone Product Information
Gene_bank_ref_id:DQ211652.1
RefSeq ORF Size:1857bp
cDNA Description:Full length Clone DNA of West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS3 with C terminal Myc tag.
Gene Synonym:WNV-NS3
Species:WNV
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:Identical with the Gene Bank Ref. ID sequence DQ211652.1 (4612..6468), corresponding to amino acid sequence YP_001527884.1.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS3 ORF mammalian expression plasmid, C-Myc tag on other vectors
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS3 ORF mammalian expression plasmid, C-GFPSpark tagVG40347-ACG$345
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS3 ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40347-ACR$345
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS3 ORF mammalian expression plasmid, N-GFPSpark tagVG40347-ANG$345
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS3 ORF mammalian expression plasmid, N-OFPSpark / RFP tagVG40347-ANR$345
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedVG40347-CF$315
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS3 ORF mammalian expression plasmid, C-His tagVG40347-CH$315
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS3 ORF mammalian expression plasmid, C-Myc tagVG40347-CM$315
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS3 ORF mammalian expression plasmid, C-HA tagVG40347-CY$315
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS3 ORF mammalian expression plasmid (Codon Optimized)VG40347-G$195
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS3 ORF mammalian expression plasmid, N-Flag tagVG40347-NF$315
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS3 ORF mammalian expression plasmid, N-His tagVG40347-NH$315
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS3 ORF mammalian expression plasmid, N-Myc tagVG40347-NM$315
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS3 ORF mammalian expression plasmid, N-HA tagVG40347-NY$315
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS3 natural ORF mammalian expression plasmidVG40347-UT$315
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: VG40347-CM
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"