Quick Order

Text Size:AAA

Human MAP1LC3A ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human MAP1LC3A cDNA Clone Product Information
Gene_bank_ref_id:BC015810
RefSeq ORF Size:366bp
cDNA Description:Full length Clone DNA of Homo sapiens microtubule-associated protein 1 light chain 3 alpha with C terminal HA tag.
Gene Synonym:RP11-346K17.1, ATG8E, LC3, LC3A, MAP1ALC3, MAP1BLC3, MAP1LC3A
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

LC3A, also known as MAP1LC3A, is one of the light chain subunits that functions together with both MAP1A and/or MAP1B. MAP1A and MAP1B are microtubule-associated proteins which mediate the physical interactions between microtubules and components of the cytoskeleton. MAP1A and MAP1B each consist of a heavy chain subunit and multiple light chain subunits. As a light chain subunit, MAP1LC3A has an important part in neuronal development and in maintaining the balance between neuronal plasticity and rigidity. MAP1LC3A is expressed as two alternatively spliced isoforms that are expressed in testis, brain, heart, liver and skeletal muscle, but are absent in thymus and peripheral blood leukocytes.

Size / Price
Catalog: HG14322-CY
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"