Quick Order

Mouse MMP-7 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
MMP7cDNA Clone Product Information
Gene_bank_ref_id:NM_010810.4
cDNA Size:804
cDNA Description:ORF Clone of Mus musculus matrix metallopeptidase 7 DNA.
Gene Synonym:MAT, Mmp7
Species:Mouse
Vector:pCMV3-N-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name
Background

Matrix metalloproteinases (MMPs) are a family of zinc-dependent endopeptidases that degrade components of the extracellular matrix (ECM) and play essential roles in various physiological and pathological processes such as morphogenesis, differentiation, angiogenesis, tissue remodeling, and tumor invasion. MMPs are synthesized as pro-enzymes and converted to active form by extracellular proteinases. MMP7, also referred to as matrilysin, is the smallest member of the MMP family and differs from other MMP members in that it lacks the C-terminal hemopexin-like domain. MMP7 is produced primarily by mucosal epithelia, and is capable of degrading various ECM proteins including proteoglycans, fibronectin, elastin and casein. This enzyme serves essential functions in both innate defense and wound healing, and appears to be one of the most important MMPs in human colon cancers. It has been reported that MMP7 contributes to tumor malignancy probably by cleaving cell surface proteins such as Fas ligand, degradation of IgG or inducing E-cadherin-mediated cell aggregation. In addition, matrilysin is also identified as a mediator of pulmonary fibrosis and a potential therapeutic target.

Size / Price
Catalog:MG50492-NM
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability2-3 weeks
Images
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"