After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human MSLN ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human MSLN cDNA Clone Product Information
Gene_bank_ref_id:BC009272
RefSeq ORF Size:1869bp
cDNA Description:Full length Clone DNA of Homo sapiens mesothelin with N terminal HA tag.
Gene Synonym:MPF, SMRP, MSLN
Species:Human
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Megakaryocyte potentiating factor belongs to the mesothelin family. This family is comprised by several mammalian pre-pro-megakaryocyte potentiating factor precursor (MPF) or mesothelin proteins. Mesothelin is a glycosylphosphatidylinositol-linked glycoprotein highly expressed in mesothelial cells, mesotheliomas, and ovarian cancer, but the biological function of the protein is not known. Megakaryocyte potentiating factor is highly expressed in mesotheliomas, ovarian cancers, and some squamous cell carcinomas (at protein level). It interacts with MUC16 and potentiates megakaryocyte colony formation in vitro. Megakaryocyte potentiating factor is secreted by several mesothelioma cell lines and is frequently elevated in the blood of patients with mesothelioma. Measurement of this protein may be useful in following the response of mesothelioma to treatment.

References
  • Chang MC, et al. (2012) Mesothelin enhances invasion of ovarian cancer by inducing MMP-7 through MAPK/ERK and JNK pathways. Biochem J. 442 (2): 293-302.
  • Nelson HH, et al. (2011) The relationship between tumor MSLN methylation and serum mesothelin (SMRP) in mesothelioma. Epigenetics. 6 (8): 1029-34.
  • Bournet B, et al. (2012) Gene expression signature of advanced pancreatic ductal adenocarcinoma using low density array on endoscopic ultrasound-guided fine needle aspiration samples. Pancreatology. 12 (1): 27-34.
  • Size / Price
    Catalog: HG13128-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"