Quick Order

Text Size:AAA

Human CADM4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CADM4cDNA Clone Product Information
cDNA Size:1167
cDNA Description:ORF Clone of Homo sapiens cell adhesion molecule 4 DNA.
Gene Synonym:NECL4, TSLL2, IGSF4C, Necl-4, synCAM4
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

Immunoglobulin superfamily member 4C (IGSF4C), also known as CADM4 or NECL-4, is an immunoglobulin (Ig) superfamily molecule showing significant homology with a lung tumor suppressor, TSLC1. CADM4/IGSF4C/NECL-4 protein is mainly expressed in the kidney, bladder, and prostate in addition to the brain. Experiments have reported the biological significance of CADM4/IGSF4C/NECL-4 in the urinary tissues. An immunohistochemical study reveals that CADM4 is expressed at the cell-cell attachment sites in the renal tubules, the transitional epithelia of the bladder, and the glandular epithelia of the prostate. IGSF4-immunoreactivity (IR) was observed diffusely in the telencephalic wall, whereas it became rather confined to the subplate, the cortical plate and the subventricular zone as the development proceeded. IGSF4-IR gradually decreased after birth and disappeared in adulthood. IGSF4 remained at low levels throughout embryonic stage, whereas it increased after birth. These spatiotemporal patterns of the expression suggest that IGSF4 plays crucial roles in the development of both telencephalon and cerebellum. CADM4/IGSF4C/NECL-4 is ectopically expressed in adult T-cell leukemia (ATL) cells, providing not only a diagnostic marker for ATL, but also a possible therapeutic target against its invasion. The distinct roles of CADM4/IGSF4C/NECL-4 in the oncogenesis of carcinomas and ATL could be due to tissue-specific differences in the downstream cascades, and is a novel concept with respect to cell adhesion in human oncogenesis.

  • Williams YN, et al. (2006) Cell adhesion and prostate tumor-suppressor activity of TSLL2/IGSF4C, an immunoglobulin superfamily molecule homologous to TSLC1/IGSF4. Oncogene. 25(10): 1446-53.
  • Ohta Y, et al. (2005) Spatiotemporal patterns of expression of IGSF4 in developing mouse nervous system. Brain Res Dev Brain Res. 156(1): 23-31.
  • Shingai T, et al. (2003) Implications of nectin-like molecule-2 /IGSF4 /RA175 /SgIGSF /TSLC1 /SynCAM1 in cell-cell adhesion and transmembrane protein localization in epithelial cells. J Biol Chem. 278(37): 35421-7.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items