After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human PFN4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PFN4cDNA Clone Product Information
cDNA Size:390
cDNA Description:ORF Clone of Homo sapiens profilin family, member 4 DNA.
Gene Synonym:PFN4
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-His Vector Information
Vector Name pCMV3-N-His
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-His Physical Map

Schematic of pCMV3-N-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

PFN4, also known as profilin 4, is a member of the profilin family. Profilin can be detected in all eukaryotic organisms. It plays an important role in the spatially and temporally controlled growth of actin microfilaments. Profilin is one of the most abundant actin monomer binders, but proteins such as CAP and (in mammals) thymosin β4 have some functional overlaps with profilin. In contrast, ADF/cofilin has some properties that antagonize profilin action. PFN4 also functions in the dynamic turnover and restructuring of the actin cytoskeleton.

  • Di Nardo A. et al., 2000, J Cell Sci. 113 (21): 3795-803.
  • Witke W. et al., 1998, EMBO J. 17 (4): 967-76.
  • Carlsson L. et al., 1977, J Mol Biol. 115 (3): 465-83.