Quick Order

Human GSTK1 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human GSTK1 cDNA Clone Product Information
Gene_bank_ref_id:BC001231
RefSeq ORF Size:681bp
cDNA Description:Full length Clone DNA of Homo sapiens glutathione S-transferase kappa 1 with C terminal HA tag.
Gene Synonym:HDCMD47P, GST, GST 13-13, GST13, GST13-13, GSTK1-1, hGSTK1, GSTK1
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

GSTK1 gene encodes a member of the kappa class of the glutathione transferase superfamily of enzymes that function in cellular detoxification. Glutathione S-transferases (GSTs) are a family of enzymes that catalyze a variety of reactions in both eukaryotes and prokaryotes. They catalyze the conjugation of reduced glutathione with potentially toxic, xenobiotic substrates, thus aiding excretion from the body. GSTK1(glutathione S-transferase kappa 1) is localized to the peroxisome and catalyzes the conjugation of glutathione to a wide range of hydrophobic substates facilitating the removal of these compounds from cells. GSTK1 functions in cellular detoxification.

References
  • Zhang QH, et al. (2001) Cloning and functional analysis of cDNAs with open reading frames for 300 previously undefined genes expressed in CD34+ hematopoietic stem/progenitor cells. Genome Res. 10(10):1546-60.
  • Morel F, et al. (2004) Gene and protein characterization of the human glutathione S-transferase kappa and evidence for a peroxisomal localization. J Biol Chem. 279(16): 16246-53.
  • Jowsey IR, et al. (2003) Biochemical and genetic characterization of a murine class Kappa glutathione S-transferase. Biochem J. 373(Pt 2):559-69.
  • Size / Price
    Catalog: HG14291-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"