Quick Order

Human PGA4 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PGA4 cDNA Clone Product Information
Gene_bank_ref_id:NM_001079808.1
RefSeq ORF Size:1164bp
cDNA Description:Full length Clone DNA of Homo sapiens pepsinogen 4, group I (pepsinogen A) with N terminal HA tag.
Gene Synonym:PGA3, PGA5, FLJ58952, FLJ77962, PGA4
Species:Human
Vector:pCMV3-SP-N-HA
Plasmid:pCMV3-HA-PGA4
Restriction Site:KpnI + XbaI (6kb + 1.17kb)
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

PGA4 (Pepsinogen 4, group I), or Pepsinogen A, is a member of the peptidase A1 family. Pepsin is expressed as a pro-form zymogen, pepsinogen, whose primary structure has an additional 44 amino acids. Pepsin is stored as pepsinogen so it will only be released when needed, and does not digest the body's own proteins in the stomach's lining. Five types of zymogens of pepsins, gastric digestive proteinases, are known: pepsinogens A, B, and F, progastricsin, and prochymosin. There are two major groups of pepsinogen, namely pepsinogen A (PGA) and pepsinogen C (PGC) (or progastricsin), and each frequently has isozymogens. The PGA3, PGA4 and PGA5 genes encode identical human pepsinogen A enzymes.

References
  • Kageyama T. (2002) Pepsinogens, progastricsins, and prochymosins: structure, function, evolution, and development. Cell Mol Life Sci. 59(2): 288-306.
  • Takahashi K. (1992) Gene structures of pepsinogens A and C. Scand J Clin Lab Invest Suppl. 210: 97-110.
  • Size / Price
    Catalog: HG13082-NY
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn StockShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"