Quick Order

Mouse CALM2 ORF mammalian expression plasmid, C-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse CALM2 cDNA Clone Product Information
NCBI RefSeq:NM_007589.5
RefSeq ORF Size:450bp
cDNA Description:Full length Clone DNA of Mus musculus calmodulin 2 with C terminal Flag tag.
Gene Synonym:AL024017, 1500001E21Rik
Species:Mouse
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Calmodulin 2, also known as CALM2, is a calmodulin. Calmodulin 2 mediates the control of a large number of enzymes, ion channels and other proteins by Ca(2+). It is involved in a genetic pathway that regulates the centrosome cycle and progression through cytokinesis. Calmodulin 2 gene may be a genetic determinant of hip osteoarthritis (OA). OA is a degenerative disease characterized by gradual loss of articular cartilage and is a leading cause of disability in elderly populations. CALM2 was most abundantly expressed in articular chondrocytes and OA cartilage.

References
  • Egli R, et al. (1993) Localization of the human bona fide calmodulin genes CALM1, CALM2, and CALM3 to chromosomes 14q24-q31, 2p21.1-p21.3, and 19q13.2-q13.3. Genomics. 16(2): 461-5.
  • Mikiko, et al. (2002) Centrosomal proteins CG-NAP and kendrin provide microtubule nucleation sites by anchoring gamma-tubulin ring complex. Mol Biol Cell. 13(9):3235-45.
  • SenGupta B, et al. (1987) Molecular analysis of human and rat calmodulin complementary DNA clones. Evidence for additional active genes in these species. J Biol Chem. 262(34): 16663-70.
  • Size / Price
    Catalog: MG51329-CF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"