Quick Order

Text Size:AAA

Human DARS Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
DARScDNA Clone Product Information
Gene_bank_ref_id:BC000629
cDNA Size:1506
cDNA Description:ORF Clone of Homo sapiens aspartyl-tRNA synthetase DNA.
Gene Synonym:PIG40, DKFZp781B11202, MGC111579, DARS
Species:Human
Vector:pCMV3-C-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
 
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name
Background

Aspartate tRNA ligase 1, also known as DARS, is part of a multienzyme complex of aminoacyl-tRNA synthetases. It belongs to the class-II aminoacyl-tRNA synthetase family. DARS charges its cognate tRNA with aspartate during protein biosynthesis. DARS catalyzes the specific attachment of an amino acid to its cognate tRNA in a 2 step reaction: the amino acid(AA) is first activated by ATP to form AA-AMP and then transferred to the acceptor end of the tRNA.

References
  • Escalante C, et al. (1993) Expression of human aspartyl-tRNA synthetase in Escherichia coli. Functional analysis of the N-terminal putative amphiphilic helix. J Biol Chem. 268(8): 6014-23.
  • Maruyama K, et al. (1994) Oligo-capping: a simple method to replace the cap structure of eukaryotic mRNAs with oligoribonucleotides. Gene. 138(1-2):171-4.
  • Reed VS, et al. (1995) Mechanisms of the transfer of aminoacyl-tRNA from aminoacyl-tRNA synthetase to the elongation factor 1 alpha. J Biol Chem. 269(52):32932-6.
  • Size / Price
    Catalog:HG14278-CY
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"