Quick Order

Text Size:AAA

Human respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
RSV-FcDNA Clone Product Information
Gene_bank_ref_id:
cDNA Size:1725
cDNA Description:ORF Clone of Human RSV (subtype A, strain A2) Fusion glycoprotein / RSV-F DNA.
Gene Synonym:F, HRSVgp08
Species:RSV
Vector:pCMV3-C-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
 
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-Myc-tagged on other vectors
Human respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-GFPSpark-tagged, expression readyVG40042-ACG$345
Human respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, expression ready, C-OFPSpark tagVG40042-ACR$345
Human respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression readyVG40042-C$315
Human respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, His-taggedVG40042-C-H$315
Human respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-FLAG-taggedVG40042-CF$315
Human respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-His-taggedVG40042-CH$315
Human respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-Myc-taggedVG40042-CM$315
Human respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-HA-taggedVG40042-CY$315
Human respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-FLAG-taggedVG40042-NF$315
Human respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-His-taggedVG40042-NH$315
Human respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-Myc-taggedVG40042-NM$315
Human respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-HA-taggedVG40042-NY$315
Human respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, untaggedVG40042-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

Human respiratory syncytial virus (HRSV) is the most common etiological agent of acute lower respiratory tract disease in infants and can cause repeated infections throughout life. It is classified within the genus pneumovirus of the family paramyxoviridae. Like other members of the family, HRSV has two major surface glycoproteins (G and F) that play important roles in the initial stages of the infectious cycle. The G protein mediates attachment of the virus to cell surface receptors, while the F protein promotes fusion of the viral and cellular membranes, allowing entry of the virus ribonucleoprotein into the cell cytoplasm. The fusion (F) protein of RSV is synthesized as a nonfusogenic precursor protein (F0), which during its migration to the cell surface is activated by cleavage into the disulfide-linked F1 and F2 subunits. This fusion is pH independent and occurs directly at the outer cell membrane, and the F2 subunit was identifed as the major determinant of RSV host cell specificity. The trimer of F1-F2 interacts with glycoprotein G at the virion surface. Upon binding of G to heparan sulfate, the hydrophobic fusion peptide is unmasked and induces the fusion between host cell and virion membranes. Notably, RSV fusion protein is unique in that it is able to interact directly with heparan sulfate and therefore is sufficient for virus infection. Furthermore, the fusion protein is also able to trigger p53-dependent apoptosis.

References
  • Martin-Gallardo A. et al., 1993, J Gen Virol. 74 (3): 453-8.
  • Jose A M. et al., 1997, J Gen Virol. 78: 2411-8.
  • Feldman SA. et al., 1999, J Virol. 73 (8): 6610-7.
  • Zlateva K.T. et al., 2004, J Virol. 78 (9): 4675-83.
  • Trento A. et al., 2006, J Virol. 80 (2): 975-84.
  • Branigan P J. et al., 2006, J Gen Virol. 87 (2): 395-8.
  • Eckardt-Michel J. et al., 2008, J. Virol. 82: 3236-49.
  • Size / Price
    Catalog:VG40042-CM
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"