After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human respiratory syncytial virus (RSV) (subtype A, strain Long) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
RSV RSV-G cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:897bp
cDNA Description:Full length Clone DNA of Human RSV (subtype A, strain Long) glycoprotein G / RSV-G with C terminal Myc tag.
Gene Synonym:G, HRSVgp07
Species:RSV
Vector:pCMV3-C-Myc
Plasmid:pCMV3-RSV-G(A-long)-Myc
Restriction Site:KpnI + XbaI (6kb + 0.94kb)
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with P20895.2.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human respiratory syncytial virus (RSV) (subtype A, strain Long) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, C-Myc tag on other vectors
Human respiratory syncytial virus (RSV) (subtype A, strain Long) glycoprotein G / RSV-G ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG40041-ACG$325
Human respiratory syncytial virus (RSV) (subtype A, strain Long) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40041-ACR$325
Human respiratory syncytial virus (RSV) (subtype A, strain Long) glycoprotein G / RSV-G ORF mammalian expression plasmid (Codon Optimized), C-Flag tagVG40041-CF$295
Human respiratory syncytial virus (RSV) (subtype A, strain Long) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, C-His tagVG40041-CH$295
Human respiratory syncytial virus (RSV) (subtype A, strain Long) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, C-Myc tagVG40041-CM$295
Human respiratory syncytial virus (RSV) (subtype A, strain Long) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, C-HA tagVG40041-CY$295
Human respiratory syncytial virus (RSV) (subtype A, strain Long) glycoprotein G / RSV-G ORF mammalian expression plasmid (Codon Optimized)VG40041-G$95
Human respiratory syncytial virus (RSV) (subtype A, strain Long) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, N-Flag tagVG40041-NF$295
Human respiratory syncytial virus (RSV) (subtype A, strain Long) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, N-His tagVG40041-NH$295
Human respiratory syncytial virus (RSV) (subtype A, strain Long) glycoprotein G / RSV-G ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG40041-NM$295
Human respiratory syncytial virus (RSV) (subtype A, strain Long) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, N-HA tagVG40041-NY$295
Human respiratory syncytial virus (RSV) (subtype A, strain Long) glycoprotein G / RSV-G ORF mammalian expression plasmid (Codon Optimized)VG40041-UT$295
 Learn more about expression Vectors
Product nameProduct name
Background

Human respiratory syncytial virus (HRSV) is the most common etiological agent of acute lower respiratory tract disease in infants and can cause repeated infections throughout life. It is classified within the genus pneumovirus of the family paramyxoviridae. Like other members of the family, HRSV has two major surface glycoproteins (G and F) that play important roles in the initial stages of the infectious cycle. HRSV G protein is a type II glycoprotein of 289-299 amino acids (depending on the virus strain) with a signal/anchor hydrophobic domain and is extensively modified by the addition of both N-and O-linked oligosaccharides to achieve the mature form of 80-90 kDa. The C-terminal ectodomain of the G protein has a central region and four cysteines which are conserved in all HRSV isolates and have been proposed as the putative receptor binding site. The G protein mediates attachment of the virus to the host cell membrane by interacting with heparan sulfate, initiating the infection. As similar to mucins in amino acid compositions, the RSV G protein can interact with host CX3CR1, the receptor for the CX3C chemokine fractalkine, and thus modulates the immune response and facilitate infection. Secreted glycoprotein G helps RSV escape antibody-dependent restriction of replication by acting as an antigen decoy and by modulating the activity of leukocytes bearing Fcgamma receptors. Unlike the other paramyxovirus attachment proteins, HRSV-G lacks both neuraminidase and hemagglutinating activities.

References
  • Martin-Gallardo A. et al., 1993, J Gen Virol. 74 : 453-8.
  • Jose AM. et al.,1997, J Gen Virol. 78: 2411-8.
  • Feldman SA. et al., 1999, J Virol. 73: 6610-7.
  • García-Beato R. et al., 2000, J Gen Virol. 81: 919-27.
  • Zlateva KT. et al., 2004, J Virol. 78: 4675-83.
  • Trento A. et al., 2006, J Virol. 80: 975-84.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"