Quick Order

Text Size:AAA

Human respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
RSV-GcDNA Clone Product Information
Gene_bank_ref_id:
cDNA Size:897
cDNA Description:ORF Clone of Human RSV (subtype A, strain A2) glycoprotein G / RSV-G DNA.
Gene Synonym:G, HRSVgp07
Species:RSV
Vector:pCMV3-C-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
 
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-Myc-tagged on other vectors
Human respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-GFPSpark-taggedVG40038-ACG$325
Human respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-OFPSpark tagVG40038-ACR$325
Human respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-FLAG-taggedVG40038-CF$295
Human respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-His-taggedVG40038-CH$295
Human respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-Myc-taggedVG40038-CM$295
Human respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-HA-taggedVG40038-CY$295
Human respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G Gene cDNA Clone (Codon Optimized, full-length ORF Clone)VG40038-G$95
Human respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-FLAG-taggedVG40038-NF$295
Human respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-His-taggedVG40038-NH$295
Human respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-Myc-taggedVG40038-NM$295
Human respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-HA-taggedVG40038-NY$295
Human respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, untaggedVG40038-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

Human respiratory syncytial virus (HRSV) is the most common etiological agent of acute lower respiratory tract disease in infants and can cause repeated infections throughout life. It is classified within the genus pneumovirus of the family paramyxoviridae. Like other members of the family, HRSV has two major surface glycoproteins (G and F) that play important roles in the initial stages of the infectious cycle. HRSV G protein is a type II glycoprotein of 289-299 amino acids (depending on the virus strain) with a signal/anchor hydrophobic domain and is extensively modified by the addition of both N-and O-linked oligosaccharides to achieve the mature form of 80-90 kDa. The C-terminal ectodomain of the G protein has a central region and four cysteines which are conserved in all HRSV isolates and have been proposed as the putative receptor binding site. The G protein mediates attachment of the virus to the host cell membrane by interacting with heparan sulfate, initiating the infection. As similar to mucins in amino acid compositions, the RSV G protein can interact with host CX3CR1, the receptor for the CX3C chemokine fractalkine, and thus modulates the immune response and facilitate infection. Secreted glycoprotein G helps RSV escape antibody-dependent restriction of replication by acting as an antigen decoy and by modulating the activity of leukocytes bearing Fcgamma receptors. Unlike the other paramyxovirus attachment proteins, HRSV-G lacks both neuraminidase and hemagglutinating activities.

References
  • Martin-Gallardo A. et al., 1993, J Gen Virol. 74 : 453-8.
  • Jose AM. et al.,1997, J Gen Virol. 78: 2411-8.
  • Feldman SA. et al., 1999, J Virol. 73: 6610-7.
  • García-Beato R. et al., 2000, J Gen Virol. 81: 919-27.
  • Zlateva KT. et al., 2004, J Virol. 78: 4675-83.
  • Trento A. et al., 2006, J Virol. 80: 975-84.
  • Size / Price
    Catalog:VG40038-CM
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"