After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse MSTN ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse MSTN cDNA Clone Product Information
Gene_bank_ref_id:NM_010834.2
RefSeq ORF Size:1131bp
cDNA Description:Full length Clone DNA of Mus musculus myostatin with N terminal Myc tag.
Gene Synonym:Cmpt, Gdf8, MGC124261, MGC124262, MGC124263, Mstn
Species:Mouse
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Background

GDF-8 / Myostatin / MSTN is a member of the bone morphogenetic protein (BMP) family and the TGF-beta superfamily. This group of proteins is characterized by a polybasic proteolytic processing site which is cleaved to produce a mature protein containing seven conserved cysteine residues. The members of this family are regulators of cell growth and differentiation in both embryonic and adult tissues. GDF-8 / Myostatin / MSTN is highly expressed in skeletal muscle, and myostatin loss-of-function leads to doubling of skeletal muscle mass. Experiments in mice have improved that GDF-8 / Myostatin / MSTN is a key regulator of mesenchymal stem cell proliferation and differentiation, and mice lacking Myostatin encoding gene show decreased body fat and a generalized increase in bone density and strength. The increase in bone density is observed in most anatomical regions, including the limbs, spine, and jaw, and myostatin inhibitors have been observed to significantly increase bone formation. GDF-8 / Myostatin / MSTN is also expressed in the early phases of fracture healing, and GDF-8 / Myostatin / MSTN deficiency leads to increased fracture callus size and strength. Together, these data suggest that GDF-8 / Myostatin / MSTN has direct effects on the proliferation and differentiation of osteoprogenitor cells, and that GDF-8/Myostatin/MSTN antagonists and inhibitors are likely to enhance both muscle mass and bone strength.

References
  • Elkasrawy MN, et al. (2010) Myostatin (GDF-8) as a key factor linking muscle mass and bone structure. J Musculoskelet Neuronal Interact. 10(1): 56-63.
  • Kambadur R, et al. (1997) Mutations in myostatin (GDF8) in double-muscled Belgian Blue and Piedmontese cattle. Genome Res. 7 (9): 910-6.
  • McPherron AC, et al. (1997) Regulation of skeletal muscle mass in mice by a new TGF-beta superfamily member. Nature. 387 (6628): 83-90.
  • Size / Price
    Catalog: MG50441-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"