Quick Order

Influenza A H1N2 (A/swine/Guangxi/13/2006) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
HAcDNA Clone Product Information
Gene_bank_ref_id:
cDNA Size:1723
cDNA Description:ORF Clone of Influenza A H1N2 (A/swine/Guangxi/13/2006) HA DNA. This cDNA clone has gone through customized codon optimization in order to obtain high level of protein expression in particular cell lines. Therefore, although the translated amino acid sequence is identical to the amino sequence on Gene Bank, the DNA sequence is different from that on Gene Bank.
Gene Synonym:HA1, Hemagglutinin
Species:H1N2
Vector:pCMV3-C-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
 
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Influenza A H1N2 (A/swine/Guangxi/13/2006) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-Myc-tagged on other vectors
Influenza A H1N2 (A/swine/Guangxi/13/2006) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-GFPSpark-tagged, expression readyVG11703-ACG$345
Influenza A H1N2 (A/swine/Guangxi/13/2006) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, expression ready, C-OFPSpark tagVG11703-ACR$345
Influenza A H1N2 (A/swine/Guangxi/13/2006) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression readyVG11703-C$315
Influenza A H1N2 (A/swine/Guangxi/13/2006) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-FLAG-taggedVG11703-CF$315
Influenza A H1N2 (A/swine/Guangxi/13/2006) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-His-taggedVG11703-CH$315
Influenza A H1N2 (A/swine/Guangxi/13/2006) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-Myc-taggedVG11703-CM$315
Influenza A H1N2 (A/swine/Guangxi/13/2006) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-HA-taggedVG11703-CY$315
Influenza A H1N2 (A/swine/Guangxi/13/2006) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-FLAG-taggedVG11703-NF$315
Influenza A H1N2 (A/swine/Guangxi/13/2006) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-His-taggedVG11703-NH$315
Influenza A H1N2 (A/swine/Guangxi/13/2006) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-Myc-taggedVG11703-NM$315
Influenza A H1N2 (A/swine/Guangxi/13/2006) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-HA-taggedVG11703-NY$315
Influenza A H1N2 (A/swine/Guangxi/13/2006) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, untaggedVG11703-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name
Size / Price
Catalog:VG11703-CM
List Price: $315.00  (Save $0.00)
Price:$315.00      [How to order]
Availability2-3 weeks
Images
    Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"