Quick Order

Text Size:AAA

Mouse IFNL3 / IL28B Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
IFNL3cDNA Clone Product Information
cDNA Size:582
cDNA Description:ORF Clone of Mus musculus interferon lambda 3 DNA.
Gene Synonym:Il28, IFL-1, Il28b, IL-28B, INF-alpha, INF-lambda
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

IL-10 Family & Receptor Related Products

Interleukin-28B (IL-28B) also known as Interferon lambda-3 and IFN-lambda-3, belongs to the type III interferon family of cytokines and are highly similar to IL-29. IL-28B belongs to the newly described interferon lambda (IFNλ) family of cytokines. IL-28B is a cytokine with immunomodulatory activity. It functions in Up-regulating MHC class I antigen expression. IL-28B displays potent antiviral activity and antitumor activity. This cytokine serves as ligand for the heterodimeric class II cytokine receptor composed of IL10RB and IL28RA. The ligand/receptor complex seems to signal through the Jak-STAT pathway. IL-28B, like IL-12, is capable of robustly enhancing adaptive immunity. Moreover, we describe for the first time how IL-28B reduces regulatory T-cell populations during DNA vaccination, whereas IL-12 increases this cellular subset. We also show that IL-28B, unlike IL-12, is able to increase the percentage of splenic CD8+ T cells in vaccinated animals, and that these cells are more granular and have higher antigen-specific cytolytic degranulation compared with cells taken from animals that received IL-12 as an adjuvant.

  • Ge D, et al.. (2009) Genetic variation in IL28B predicts hepatitis C treatment-induced viral clearance. Nature. 461(7262): 399-401.
  • Morrow MP, et al.. (2009) Comparative ability of IL-12 and IL-28B to regulate Treg populations and enhance adaptive cellular immunity. Blood. 113(23): 5868-77.
  • Sheppard P, et al.. (2003) IL-28, IL-29 and their class II cytokine receptor IL-28R. Nat Immunol. 4(1): 63-8.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items