Quick Order

Human ATP1B1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ATP1B1cDNA Clone Product Information
Gene_bank_ref_id:BC000006
cDNA Size:912
cDNA Description:ORF Clone of Homo sapiens ATPase, NA+/K+ transporting, beta 1 polypeptide DNA.
Gene Synonym:ATP1B, MGC1798, ATP1B1
Species:Human
Vector:pCMV3-C-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
 
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name
Background

ATP1B1 belongs to the family of Na+/K+ and H+/K+-ATPases beta chain proteins, and to the subfamily of Na+/K+ -ATPases. ATP1B1 is a subunit of Na+/K+-ATPase. Na+/K+-ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. Na+/K+-ATPase is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). ATP1B1 regulates, through assembly of alpha/beta heterodimers, the number of sodium pumps transported to the plasma membrane. ATP1B1 is the non-catalytic component of the active enzyme, which catalyzes the hydrolysis of ATP coupled with which catalyzes the hydrolysis of ATP coupled with the exchange of Na+ and K+ ions across the plasma membrane.

References
  • Lingrel JB. et al., 1990, Prog Nucleic Acid Res Mol Biol. 38: 37-89.
  • Oakey RJ. et al., 1993, Hum Mol Genet. 1 (8): 613-20.
  • Ushkaryov YuA. et al., 1990, FEBS Lett. 257 (2): 439-42.
  • Size / Price
    Catalog:HG14255-CY
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"