Quick Order

Human EZR ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human EZR cDNA Clone Product Information
Gene_bank_ref_id:NM_001111077.1
RefSeq ORF Size:1761bp
cDNA Description:Full length Clone DNA of Homo sapiens ezrin with N terminal HA tag.
Gene Synonym:CVL, CVIL, VIL2, HEL-S-105
Species:Human
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

VIL2, also known as villin-2, belongs to the ERM protein family. It is expressed in cerebral cortex, basal ganglia, hippocampus, hypophysis, and optic nerve. VIL2 contains 1 FERM domain and may be involved in connections of major cytoskeletal structures to the plasma membrane. It plays a key role in cell surface structure adhesion, migration, and organization. In epithelial cells, VIL2 is required for the formation of microvilli and membrane ruffles on the apical pole. It interacts with MPP5 and SLC9A3R2. It is found VIL2 form a complex with PODXL and SLC9A3R2. It also interacts with MCC, PLEKHG6, PODXL, SCYL3/PACE1, SLC9A3R1 and TMEM8B.

References
  • Grnholm M, et al. (1999) Homotypic and heterotypic interaction of the neurofibromatosis 2 tumor suppressor protein merlin and the ERM protein ezrin. J Cell Sci. 112(6):895-904.
  • Sitaraman, et al. (2002) The adenosine 2b receptor is recruited to the plasma membrane and associates with E3KARP and Ezrin upon agonist stimulation. J Biol Chem. 277(36):33188-95.
  • Gould KL, et al. (1989) cDNA cloning and sequencing of the protein-tyrosine kinase substrate, ezrin, reveals homology to band 4.1. EMBO J. 8(13):4133-42.
  • Size / Price
    Catalog: HG12858-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"