Quick Order

Human PLS3 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PLS3 cDNA Clone Product Information
NCBI RefSeq:BC039049
RefSeq ORF Size:1893bp
cDNA Description:Full length Clone DNA of Homo sapiens plastin 3 with N terminal His tag.
Gene Synonym:T-plastin
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

PLS3, also known as plastin 3, belongs to the plastin family. Members of this family are actin-binding proteins that are conserved throughout eukaryote evolution and expressed in most tissues of higher eukaryotes. There are two ubiquitous plastin isoforms in humans: L and T. The L isoform is expressed only in hemopoietic cell lineages, while the T isoform has been found in all other normal cells of solid tissues that have replicative potential (fibroblasts, endothelial cells, epithelial cells, melanocytes, etc.). PLS3 contains 2 actin-binding domains, 4 CH (calponin-homology) domains and 2 EF-hand domains. It is expressed in a variety of organs, including muscle, brain, uterus and esophagus.

References
  • Lin CS. et al., 1993, J Biol Chem 268 (4): 2781-92.
  • Goldstein D. et al., 1985, Cancer Res. 45 (2): 5643-7.
  • Arpin M. et al., 1995, J Cell Biol. 127 (2): 1995-2008.
  • Size / Price
    Catalog: HG15042-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"