Quick Order

Text Size:AAA

Human RPE ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human RPE cDNA Clone Product Information
Gene_bank_ref_id:BC005148
RefSeq ORF Size:687bp
cDNA Description:Full length Clone DNA of Homo sapiens ribulose-5-phosphate-3-epimerase with C terminal HA tag.
Gene Synonym:HUSSY-17, MGC2636, RPE2-1, RPE
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

The "ribulose phosphate binding" superfamily defined by the Structural Classification of Proteins (SCOP) database is considered the result of divergent evolution from a common (beta/alpha)(8)-barrel ancestor. The superfamily includes d-ribulose 5-phosphate 3-epimerase (RPE), orotidine 5'-monophosphate decarboxylase (OMPDC), and 3-keto-l-gulonate 6-phosphate decarboxylase (KGPDC). Replication of the human genome requires the activation of thousands of replicons distributed along each one of the chromosomes. Each replicon contains an initiation, or origin, site, at which DNA synthesis begins. In enzymology, a L-ribulose-5-phosphate 3-epimerase is an enzyme that catalyzes the chemical reaction L-ribulose 5-phosphate to L-xylulose 5-phosphate. Hence, RPE has one substrate, L-ribulose 5-phosphate, and one product, L-xylulose 5-phosphate. RPE belongs to the family of isomerases, specifically those racemases and epimerases acting on carbohydrates and derivatives. The systematic name of this enzyme class is L-ribulose-5-phosphate 3-epimerase. Other names in common use include L-xylulose 5-phosphate 3-epimerase, UlaE, and SgaU.

References
  • Yew WS, et al., 2002,  J. Bacteriol. 184 (1): 302-6.
  • Shimaoka, M. et al., 2005, Biosci Biotechnol Biochem  69 (7):1248-55.
  • Salinero,KK. et al., 2009,  BMC Genomics 10 :351.
  • Size / Price
    Catalog: HG14238-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"