After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse MDH1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
MDH1cDNA Clone Product Information
Gene_bank_ref_id:NM_008618.3
cDNA Size:1005
cDNA Description:ORF Clone of Mus musculus malate dehydrogenase 1, NAD (soluble) DNA.
Gene Synonym:MDHA, Mor2, MDH-s, Mor-2, D17921, B230377B03Rik
Species:Mouse
Vector:pCMV3-N-FLAG
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-FLAG Vector Information
 
Vector Name pCMV3-N-FLAG
Vector Size 6098bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-N-FLAG Physical Map
Schematic of pCMV3-N-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name
Background

Malate dehydrogenases 1(MDH1 / MDHA) is soluable form of malate dehydrogenases. Malate dehydrogenases (MDH) is a group of multimeric enzymes consisting of identical subunits usually organized as either dimer or tetramers with subunit molecular weights of 30-35 kDa. MDH has been isolated from different sources including archaea, eubacteria, fungi, plant and mammals. MDH catalyzes the NAD/NADH-dependent interconversion of the substrates malate and oxaloacetate. This reaction plays a key part in the malate / aspartate shuttle across the mitochondrial membrane, and in the tricarboxylic acid cycle within the mitochondrial matrix. The enzymes share a common catalytic mechanism and their kinetic properties are similar, which demonstrates a high degree of structural similarity. The three-dimensional structures and elements essential for catalysis are conserved between mitochondrial and cytoplasmic forms of MDH in eukaryotic cells even though these isoenzymes are only marginally related at the level of primary structure. 

References
  • Minarik P, et al. (2002) Malate dehydrogenases--structure and function. Gen Physiol Biophys. 21 (3): 257-65.
  • Musrati RA, et al. (1998) Malate dehydrogenase: distribution, function and properties. Gen Physiol Biophys. 17 (3): 193-210.
  • Hall MD, et al. (1992) Crystal structure of Escherichia coli malate dehydrogenase. A complex of the apoenzyme and citrate at 1.87 A resolution. J Mol Biol. 226 (3): 867-82.
  • Size / Price
    Catalog:MG51330-NF
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"