Quick Order

Text Size:AAA

Human TSPAN31 ORF mammalian expression plasmid, C-HA tag

DatasheetReviewsRelated ProductsProtocols
Human TSPAN31 cDNA Clone Product Information
NCBI RefSeq:BC010377
RefSeq ORF Size:633bp
cDNA Description:Full length Clone DNA of Homo sapiens tetraspanin 31 with C terminal HA tag.
Gene Synonym:SAS, TSPAN31
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

TSPAN31 is a member of the transmembrane 4 superfamily. Most members of this family are cell-surface proteins that are characterized by the presence of four hydrophobic domains. They mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. TSPAN31 is thought to be involved in growth-related cellular processes. This gene is associated with tumorigenesis and osteosarcoma.

References
  • Wright MD. et al., 1995, Immunol Today. 15 (12): 588-94.
  • Meltzer PS. et al., 1992, Cell Growth Differ. 2 (10): 495-501.
  • Jankowski SA. et al., 1995, Genomics. 25 (2): 501-6.
  • Size / Price
    Catalog: HG14231-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"