Quick Order

Text Size:AAA

Human AIF1 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human AIF1 cDNA Clone Product Information
NCBI RefSeq:BC009474
RefSeq ORF Size:444bp
cDNA Description:Full length Clone DNA of Homo sapiens allograft inflammatory factor 1 with C terminal HA tag.
Gene Synonym:DADB-70P7.8, AIF-1, IBA1, IRT-1, IRT1, AIF1
Species:Human
Vector:pCMV3-C-HA
Plasmid:pCMV3-AIF1-HA
Restriction Site:KpnI + XbaI (6kb + 0.49kb)
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human AIF1 Gene Plasmid Map
Human AIF1 natural ORF mammalian expression plasmid, C-HA tag
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

AIF1, also known as IBA1, is an actin-binding protein. AIF1 is expressed selectively in human macrophage-like cell lines, and in a subset of CD68(+) macrophages in the interstitial and perivascular spaces of human heart allografts. It is expressed in macrophages and neutrophils. AIF1 enhances membrane ruffling and RAC activation. AIF1 enhances the actin-bundling activity of LCP1. It also enhances lymphocyte migration. AIF1 may play a role in macrophage activation and function. It binds calcium and plays a role in RAC signaling and in phagocytosis. It promotes the proliferation of vascular smooth muscle cells and of T-lymphocytes.

Size / Price
Catalog: HG14227-CY
List Price:   (Save )
Price:      [How to order]
AvailabilityIn StockShipping instructions
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"