After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse GRN Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
GRNcDNA Clone Product Information
Gene_bank_ref_id:NM_008175.4
cDNA Size:1770
cDNA Description:ORF Clone of Mus musculus granulin DNA.
Gene Synonym:epithelin, Grn
Species:Mouse
Vector:pCMV3-N-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name
Background

&Granulins are a family of secreted, glycosylated peptides that are cleaved from a single precursor protein with 7.5 repeats of a highly conserved 12-cysteine granulin/epithelin motif. The precursor protein, progranulin, is also called proepithelin and PC cell-derived growth factor. Cleavage of the signal peptide produces mature granulin which can be further cleaved into a variety of active, 6 kDa peptides. These smaller cleavage products are named granulin A, granulin B, granulin C, etc. Epithelins 1 and 2 are synonymous with granulins A and B, respectively. Both the peptides and intact granulin protein regulate cell growth. However, different members of the granulin protein family may act as inhibitors, stimulators, or have dual actions on cell growth. Granulin family members are important in normal development, wound healing, and tumorigenesis. Granulins have possible cytokine-like activity. They may play a role in inflammation, wound repair, and tissue remodeling. Granulin-4 promotes proliferation of the epithelial cell line A431 in culture while granulin-3 acts as an antagonist to granulin-4, inhibiting the growth. Granulin expression inhibited Tat transactivation, and tethering experiments showed that this effect was due, at least in part, to a direct action on cyclin T1 in the absence of Tat.

References
  • Hoque M, et al. (2003) The growth factor granulin interacts with cyclin T1 and modulates P-TEFb-dependent transcription. Mol Cell Biol. 23(5): 1688-702.
  • Bateman A, et al. (1990) Granulins, a novel class of peptide from leukocytes. Biochem Biophys Res Commun. 173(3): 1161-8.
  • Trinh DP, et al. (1999) Epithelin/granulin growth factors: extracellular cofactors for HIV-1 and HIV-2 Tat proteins. Biochem Biophys Res Commun. 256(2): 299-306.
  • Size / Price
    Catalog:MG50396-NM
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"