Quick Order

Text Size:AAA

Human MICA ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human MICA cDNA Clone Product Information
Gene_bank_ref_id:BC016929
RefSeq ORF Size:1152bp
cDNA Description:Full length Clone DNA of Homo sapiens MHC class I polypeptide-related sequence A with N terminal HA tag.
Gene Synonym:MIC-A, PERB11.1, MICA
Species:Human
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

MHC class I chain-related molecules A (MICA) is one of the genes in the HLA class I region, which belongs to MHC class I family. It is the member of the non-classical class I family that displays the greatest degree of polymorphism. The MICA protein product is expressed on the cell surface, although unlike canonical class I molecules does not seem to associate with beta-2-microglobulin. It is thought that MICA functions as a stress-induced antigen that is broadly recognized by NK cells, NKT cells, and most of the subtypes of T cells. The Natural killer group 2D (NKG2D), a C-type lectin-like activating immunoreceptor, is a receptor of MICA, which was detected on most gammadelta T cells, CD8+ alphabeta T cells, and natural killer (NK) cells. Effector cells from all these subsets could be stimulated by ligation of NKG2D. Engagement of NKG2D activated cytolytic responses of gammadelta T cells and NK cells against transfectants and epithelial tumor cells expressing MICA. The MICA system is a novel, avidin-free immunohistochemical detection system that provides a significant increase in sensitivity compared to traditional immunodetection systems.

References
  • Choy MK, et al. (2010) MICA polymorphism: biology and importance in immunity and disease. Trends Mol Med. 16(3): 97-106.
  • Li J, et al. (2005) Distinct pattern of human Vdelta1 gammadelta T cells recognizing MICA. Cell Mol Immunol. 2(4): 253-8.
  • Mangham DC, et al. (2000) MICA-a highly sensitive and avidin-free immunohistochemical detection system. Adv Anat Pathol. 7(6): 360-4.
  • Bauer S, et al. (1999) Activation of NK cells and T cells by NKG2D, a receptor for stress-inducible MICA. Science. 285(5428): 727-9.
  • Groh V, et al. (1998) Recognition of stress-induced MHC molecules by intestinal epithelial gammadelta T cells. Science. 279: 1737-40.
  • Size / Price
    Catalog: HG12302-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"