Quick Order

Text Size:AAA

Human HSF1 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human HSF1 cDNA Clone Product Information
Gene_bank_ref_id:BC014638
RefSeq ORF Size:1590bp
cDNA Description:Full length Clone DNA of Homo sapiens heat shock transcription factor 1 with N terminal HA tag.
Gene Synonym:HSTF1, HSF1
Species:Human
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Heat shock factor protein 1, also known as heat shock transcription factor 1, HSF1 and HSTF1, is a cytoplasm and nucleus protein which belongs to the HSF family. HSF1 is the major transcription factor of HSPs (heat shock proteins) in response to various stresses. Wild type HSF1 (heat shock transcriptional factor 1) is normally inactive. HSF1 / HSTF1 is a DNA-binding protein that specifically binds heat shock promoter elements (HSE) and activates transcription. In higher eukaryotes, HSF is unable to bind to the HSE unless the cells are heat shocked. HSF1 / HSTF1 protects cells and organisms against various types of stress, either by triggering a complex response that promotes cell survival or by triggering cell death when stress-induced alterations cannot be rescued. HSF1 / HSTF1 is the key protein in regulating stress response. It can be activated under heat, oxidative or another stress conditions. Dominant-positive and dominant-negative HSF1 are two types of HSF1 mutants. Both of them gain the DNA binding activity in the absence of stress. In addition, dominant-positive HSF1 acquires transcriptional activity, which dominant-negative HSF1 does not acquire. HSF1 / HSTF1 was also reported to contribute to cell resistance against genotoxic stress, such as that caused by doxorubicin, an anticancer drug in common clinical use.

References
  • Holmberg,C.I. et al., 2000, Cell Stress Chaperones.5 (3):219-28.
  • Huang,Y.H. et al., 2007, Sheng Wu Gong Cheng Xue Bao. 23 (6): 971-5.
  • Salmand,P.A. et al.,2008, Biol Reprod  79 (6): 1092-101.
  • Lee,Y.J. et al., 2008, Cancer Res  68 (18): 7550-60.
  • Hou,Y. et al., 2009, Mol Biol Rep. 36 (8): 2271-7.
  • Size / Price
    Catalog: HG12245-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"